Glucose-6-phosphate dehydrogenase (G6PD) is a critical enzyme involved in the metabolism of glucose,especially in red blood cells. Deficiencies in the enzymeare the most common human enzyme defect and occurat a high frequency in certain populations of East Africanchildren.a. Offer one hypothesis for the high incidence of G6PDmutations in East African children.b. How would you test your hypothesis further?c. Scores of different G6PD mutations affecting enzyme function have been found in human populations.Offer one explanation for the abundance of differentG6PD mutations.

Q: 6a. C. elegans display a very characteristic sinusoidal movement, like a snake slithering. Imagine…

A: The movement of C. elegans, resembling a sinusoidal motion, is a distinct characteristic of these…

Q: a. Explain how you could use worms transformedwith myo-2::GFP to find mutations that disrupt…

A: The alteration of the DNA sequence of the genome in an organism is termed as mutation. It is the…

Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…

A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…

Q: After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3…

A: Bacteria are dynamically evolving microbes. Various experiments suggest the evolution process of…

Q: Leber's Hereditary Optic Neuropathy (LHON) is a disease that involves degeneration of neural cells…

A: The mitochondrion is an organelle that is found in large numbers in most eukaryotic cells. The…

Q: Fill up the blank  __________s are blood diseases caused by mutationsthat eliminate or reduce the…

A: The blood is the fluid connective tissue that is essential for the transport of oxygen,…

Q: Leber’s Hereditary Optic Neuropathy (LHON) is a disease that involves degeneration of neural cells…

A: IMPORTANT POINT IO NOTE. 1.  It cause loss of central vision by degeneration retinal ganglion cells…

Q: Tay–Sachs disease is a severe autosomal recessive genetic disease that produces deafness, blindness,…

A: Tay-Sachs disease is a neurodegenerative disease that is caused by the mutation of the gene HEXA…

Q: Deletions in the mitochondrial DNA can result in parasitic mitochondria which do not respire but…

A: This can be explained on the basis of use and disuse of organs. The organs that are not usually…

Q: What is/are product(s) from commensal bacteria that regulate the expression for ler, regulator of…

A:

Q: Define the following terms: a. point mutation b. transition mutation c. transverse mutation d.…

A: Mutation was the alteration in the DNA sequence  which result in change in the structure of the…

Q: We use the Alu element polymorphism to trace each student's ancestry. This element is present in an…

A: Introduction  Polymorphism refers to the occurrence of multiple genetic variants, or alleles, within…

Q: Kearns-Sayre syndrome (KSS), Pearson syndrome,and progressive external opthalmoplegia (PEO) arerare…

A: It is given that Kearns-Sayre syndrome (KSS), Pearson syndrome, and progressive external…

Q: ckle cell anemia is a hereditary disease in which a faulty hemoglobin (Hb S) molecule is produced. A…

A: Hemoglobin is an iron-containing protein present in the red blood cells (RBCs). It transports oxygen…

Q: Which of the following would be required to produce a forelimb in snakes? Briefly explain your…

A: Reptiles are the group of animals that belong to the class reptilian of vertebrates. Reptiles…

Q: A21. Two single-base substitutions in the trpA gene of E.coli both affected amino acid number 234.…

A: Missense mutation defines the alteration of genetic code/codon via the single base pair…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal…

A: Protein electrophoresis is a method that separates proteins based on their size and the electrical…

Q: Refer to question 3 in More Genetic TIPS before answering thisquestion. Based on the…

A: The multiple sequence alignment is an alignment sequence of three or more than three biological…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia (AML) is a kind of blood cancer.

Q: In a line of human cells grown in culture, a geneticist isolates a temperature-sensitive mutation at…

A: Histone acetyltransferase (HATs) are those enzymes which can acetylate the lysine amino acids on…

Q: he following statements is FALSE [ Select] [Select ] Sickle-cell anemia results in lower oxygen…

A: Sickle Cell anaemia is an autosomal recessive disease in which the hemoglobin is affected and…

Q: ee modes of dosage compensation exist in nature. riefly, describe the three different strategies.…

A: Males and females of several species have different sex chromosomes and in order to  equalise their…

Q: Which of the following experimental observations suggest that adisease has a genetic basis?A. The…

A: Gene is a functional unit of heredity. A gene is a sequence of nucleotides in genome that codes for…

Q: here is a benign congenital condition called Hereditary Persistence of Fetal Hemoglobin (HPFH) in…

A: Hereditary Persistence of Fetal Hemoglobin is the condition when there is still fetal hemoglobin…

Q: Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the…

A: Any kind of alteration in the nucleotide sequence of an organism’s genome is referred to as a…

Q: Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene…

A: Mutations in the following gene gives rise to a genetic disorder known as Xeroderma pigmentosum.…

Q: freshwater water fleas (Daphnia) develop without hemoglobin (Hb) and are whitish when living in…

A: With the exception of Leptodora, which can grow up to 18 mm in length, the aquatic organisms in the…

Q: Through GWAS explorations, scientists have identified several SNPs linked to obesity in people who…

A: Fat mass and obesity associated protein (FTO) is otherwise known as alpha-ketoglutarate-dependent…

Q: 5. In class we described two post-translational modifications which could be used to control…

A: The enzymes are the proteins. They are coded by the gene sequences present in the DNA. These gene…

Q: . Figure 18-14 presents haplotype data for the G6PD genein a worldwide sample of people.a. Draw a…

A: A single nucleotide polymorphism, is a difference between individuals in a single spot in a DNA…

Q: Of all the genes in the human genome, the ones withthe most characterized Alu insertions are those…

A: Introduction  Transposons are the short highly repeated DNA sequence present in heterochromatic…

Q: Some people have a genetic predisposition for developing priondiseases. Examples are described in…

A: Viruses are acellular organisms that lack a typical cellular structure like a bacterium. It is a…

Q: If a mutation in a homeotic gene produced the following phenotypes, would you expect it to be a…

A: Mutation refers to the sudden changes that occur in the sequence of DNA’s (deoxyribonucleic acid)…

Q: The study of the b-globin gene helped establish the one gene-one polypeptide relationship. Which of…

A: Mutation is a random process. It leads to change the nucleotide in a sequence of a gene.

Q: Domestic dogs are closely related to wolves. Wolves have one copy of the gene that encodes the…

A: Evolution of dogs from the wolves occurred from about 11000 years ago.Wolves have only 1 copy of the…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: WT A B с D E F G H WT A + + B + C DE + + + + F + G H + + + The above complementation table analyzes…

A:

Q: Based on the data provided, explain how cellular processes must be altered in stomach cancer cells…

A: In comparison to healthy cells, cancer cells have an active metabolism and need more energy. Cancer…

Q: A weight (g) -Cmah-- HFD wild type HFD 50₁ -Cmah-/-NCD -wild type NCD 40- 30- 20+ T 0 2 4 9 8 10 12…

A: The given graph represents the data of an experiment performed in mice to observe the effect of…

Q: Many neurodegenrative diseases are thought to be caused by increased levels of unfolded proteins.…

A: Neurodegenerative diseases are caused by the accumulation of misfolded proteins. Examples of…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.