Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b) ACCCA (c) GTGTC

Q: Outline the principle of how you would synthesise a library of approximately 1000 10-residue…

A: INTRODUCTION Oligonucleotide synthesis is the chemical synthesis of relatively short fragments of…

Q: For some DNAS it is possible to separate the two strands, after denaturation, in a CsCl gradient.…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a)…

A: Denaturation is a process in which proteins or nucleic acids lose the quarternary structure,…

Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…

A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…

Q: Using the first and second base key below, predict the DNA sequence given by the SOLID color…

A: Answer:- Nitrogenous bases are crucial components of nucleotides, which are the building blocks of…

Q: How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to…

A: tRNA is a small, well-characterized RNA molecule which plays a key role in protein biosynthesis.…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: (a) Draw the structure of the high-energy nucleoside triphosphate GTP. (b) Draw the structure of the…

A: In the biological system, there are several metabolic reactions that occur that result in the…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: Transfer RNA (tRNA) molecules contain a sequence of three nucleotides known as the anticodon. It is…

Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Would the base pair Guanosine and Cytosine be more or less stable at pH 10

A: The stability of a base pair like Guanosine (G) and Cytosine (C) can be influenced by pH, but in the…

Q: An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G= 15%. (A) Is this…

A: DNA is composed of nucleotide. In nuclear tide there is one ribose sugar, one phosphate  molecule…

Q: Write a balanced equation for the hydrolytic deamination of a DNA- 5-methylcytosine residue.

A: Deamination is the process of breaking down amino acids in which amino group is converted into…

Q: Do any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA?…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms (except few viruses) that…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…

A: Mutation can be divided into several categories. The types of mutation include missense mutation,…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: if this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long.…

A: Given: DNA - molecular weight = 1.20 ×108 Dalton The molecular weight of a nucleotide pair = 600…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: The following are sequences from three different alpha helices found in human proteins:…

A: The proteins are constituted of twenty naturally occurring amino acids connected via peptide…

Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…

A: Ans - a.)  5’- G A G C G A T C G C T C - 3’                       3'- C  T C G C T A G C G A G -5'…

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: Given a polynucleotide sequence such as GAATTC,explain what further information you would need…

A: A deoxyribonucleotide of DNA is formed by crosslinking orthophosphoric acid, deoxyribose sugar, and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.