Gene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in an intron of gene X. Which would be the most likely effect of this mutation on the biomolecules in the cell? The amount of pre-mRNA transcribed from gene X would be less than normal.  The amount of functional protein corresponding to gene X would be less than normal.  The ability of snRNAs to form a spliceosome would be diminished. The breakdown of mature mRNA corresponding to gene X would be faster

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Which statement is FALSE? Group of answer choices   Histones are very conserved at the primary…

A: 2nd statementis false. H1 doesn't contain histone fold domain. H2A, H2B, H3 and H4 have HFD

Q: ATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of…

A: ATM (Ataxia Telangiectasia Mutated) is a protein kinase that plays a critical role in the cellular…

Q: A certain membrane protein is found on the ER membrane with the N-terminus on the ER side of the…

A: This question is about the orientation of a particular membrane protein within the endoplasmic…

Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…

A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription  It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT:   Question 9…

A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…

Q: Suppose that a 20-bp deletion occurs in the middle of exon 2 of the gene depicted in Figure 14.12a.…

A: Alternative processing and splicing results in the production of multiple mRNA and proteins from the…

Q: Select the three post-transcriptional modifications often seen in the processing of mRNA in…

A: 5'-capping; 3'-poly(A) tail addition; splicing

Q: Genetic expression involves transcription and translation. Match the structure or molecule to the…

A: We all know that central dogma is a very basic and important procedure in every cell.There are…

Q: Eukaryotes modify mRNA with an m7G cap: an  N7-methylated guanosine linked via a 5′ to 5′…

A: The capping of mRNA is a mechanism that prevents the mRNA strand from being degraded by exonucleases…

Q: In this chapter you were introduced to nonsense suppressor mutations in tRNA genes. However,…

A: The sequence of amino acids in the protein determines the conformation (or folding) of the protein…

Q: identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A…

A: Transcription is the process which comprises of synthesis of mRNA from the DNA inside the nucleus of…

Q: Considering Figure 2-13, if you had a homozygous double mutant m3/m3 m5/m5, would you expect it to…

A: In biology, a mutation is a change in the nucleotide sequence of an organism's genome, virus genome,…

Q: This is the sense strand of a mammalian gene. Determine the sequence of the mature mRNA. Assume…

A: CGUAAAUCGUAGGUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAGGGCUUUGGACCGAUAGAUGCGACCCUGGAGGUAAGUAUAGAUAAUUAAGCACAGG…

Q: SR proteins are essential to proper spliceosome assembly and are known to take part in the…

A: Alternative splicing is a type of RNA processing in which a single gene can produce multiple…

Q: Order the following choices to indicate the sequence of steps in the process of elongation of a…

A: The process of translation involves the synthesis of polypeptide chain and proceeds in three stages:…