This is the sense strand of a mammalian gene. Determine the sequence of the mature mRNA. Assume transcription starts approxiamtely 25 bp downstreams from the TATAAT box, that the 5' splice site is AG/GUAAGU and that the 3' splice site is AG\GN. / marks the 5' splice site and \ marks the 3' splice site. N means any nucleotide. (In this problem, there are no branch point A's or polyY tracts. Please mark the splice sites as defined above. (5'=/ and 3'=\) and underline the mature mRNA. Do not use alternate splicing. TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGT ATGATAGGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATAATTAAGCACAGGCATGCA GGGATATCCTCCAAATAGGTAAGTAACCTTACGGTCAATTAATTAGGCAGTAGATGAATAAACGATAT CGATCGGTTAGGTAAGTCTGAT
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
This is the sense strand of a mammalian gene. Determine the sequence of the mature mRNA. Assume transcription starts approxiamtely 25 bp downstreams from the TATAAT box, that the 5' splice site is AG/GUAAGU and that the 3' splice site is AG\GN. / marks the 5' splice site and \ marks the 3' splice site. N means any
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGT
ATGATAGGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATAATTAAGCACAGGCATGCA
GGGATATCCTCCAAATAGGTAAGTAACCTTACGGTCAATTAATTAGGCAGTAGATGAATAAACGATAT
CGATCGGTTAGGTAAGTCTGAT

Trending now
This is a popular solution!
Step by step
Solved in 2 steps









