Answered: For this oligonucleotide, • Classify…

For this oligonucleotide, • Classify if RNA or DNA? Justify your choice. • Determine the sequence of this segment, labeling the 5’ and 3’ ends.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: How do you do this? can you explain and show me? Replication Given Original DNA strand: ATCCTAGCC.…

A: Replication is the process by which a double stranded DNA molecule is copied to produce to identical…

Q: A hypothetical protein has a molar mass of 23,300 Da. Assume that the average molar mass of an amino…

A: Amino acids are organic compounds that combine to form proteins; thus, they are known as protein…

Q: 4. What would be the code that the methionine tRNA anticodon would carry? 5. Suppose…

A: codon are three nucleotide sequence either DNA or RNA that codes for a specific amino acid during…

Q: Sketch a DNA molecule (in a vertical lateral position) and connect the the appropriate region in the…

A: DNA is a double helix molecule made up of sugar phosphate backbone and nitrogenous bases like…

Q: RNA polymerase transcribes the following DNA template strand: 5' ACC TTT CCG 3' What is the RNA…

A: Gene is the sequence of nucleotides that encode a particular protein.

Q: Source E coli 23.9 24.9 25.2 26.0 Yeast 31.3 32.9 18.7 17.1 Sea urchin 32.8 32.1 17.7 18.4 Rat 28.6…

A: DNA is a double-helical structure that is composed of two antiparallel strands that are wound to…

Q: ext, let's work through the 1st part of the process: TRANSCRIPTION. sing the sequence found in the…

A: The method of copying a part of DNA into RNA is known as transcription. Messenger RNA is made up of…

Q: Understand Reverse/forwards strands and reverse complementary strand 5’-GCATGCAT-3’ Write down the…

A: A series of bases in a nucleic acid can form a double-stranded arrangement by combining base pairs.…

Q: Build a 3D model of a DNA molecule: -3-dimensional built structure -Contain sugar-phosphate…

A: The DNA or the deoxyribonucleic acid is the polymer of nucleotides present in the nucleus in the…

Q: The Structures of Genetic Material • DNA is made up of called a • DNA is made up of consisting of 3…

A: Deoxyribonuclic acid (DNA) is an organic molecule or compaund, which contains genetic information as…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: Please ASAP. Thank you

A: From above questions Correct pairing of scientist and his contribution given below.

Q: Challenge #1: Can you go from MRNA back to DNA (and to the amino acids?) DNA CGA UUC CAG GUG UAA AAC…

A: mRNA is also called as messenger RNA which is a single-stranded RNA molecule complementary to the…

Q: Protein Synthesis and Mutation Practice Complete the lines below by determining the mRNA transcript…

A: The method of protein synthesis is central to cellular work and includes transcription and…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: In extracting and Isolating a DNA from yeast and fruit. • What is the role of salt and dishwashing…

A: DNA is the genetic material of most cells and its extraction is necessary for analysis,…

Q: 3. Understand Reverse/forwards strands and reverse complementary strand Example sequence…

A: Transcription is the process by which the nucleotide sequence of the DNA (deoxyribonucleic acid) is…

Q: • In a ______________, DNA wraps twice around a corecomposed of histones H2A, H2B, H3, and H4.…

A: Chromosomes are the structure in which genes are located. Eukaryotic chromosomes are composed of…

Q: Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the…

A: With bioinformatics techniques like BLAST, it is often possible to determine a gene from a DNA…

Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us practice decoding DNA! Fill in the complimentary DNA…

A: DNA is what codes for all the cellular genetic information on earth . All cellular life forms from a…

Q: DNA fragments cut by restriction enzymes can form two types of ends. What are these ends called? •…

Q: The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The…

A: Restriction enzymes identify and cut DNA at specific nucleotide sequences. A restriction site is a…

Q: S SimUText 2019-2020 X File Edit Go Tools Help Recycle Bin Section 1: DNA Structure NOTES 17/18…

A: The following picture depicts a nitrgenous base, a phosphate group and a deoxyribose sugar.

Q: What is the Central Dogma of biology? •. Name FOUR polymers in your body right nOW.

A: Central dogma of biology is the process of synthesizing protein from DNA.It was first proposed by…

Q: Which two restriction enzymes where used to completely digest the DNA fragment above based on the…

A: Restriction endonucleases are the enzymes which cleave the DNA at specific sites from within and…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…

A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…

Q: Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each…

A: RNA and DNA are the two types of nucleic acids present in the living system. Nucleic acids are…

Q: What is Recombinant DNA?

A: Question is about recombinant DNA .

Q: O Macmillan Learning Translate the mRNA, starting at the first 5' nucleotide, assuming that…

A: given mRNA sequence:AUG GGU CGU GAG UCA UCG UUA AUU GUA GCU GGA GGG GAG GAA UGA_ therefore amino…

Q: 8 7 2 6. 3 4 000 000 DO0

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: © Macmillan Learning Predict the amino acid sequences of peptides formed by ribosomes in response to…

A: In an mRNA sequence, a group of three bases (codon) is code for a specific amino acid. In the…

Q: How many PAM sequences are present in the sequence below?…

A: Protospacer adjacent motif(PAM) sequence It is a short DNA sequence(usually 2-6 base pairs in…

Q: Transcribe the DNA sequence that follows. What type of molecule did you make? How many codons are…

A: DNA is made up of nitrogenous bases, deoxyribose sugar, and phosphate. DNA acts as genetic material…

Q: Guide Questlons: How do the nucleotides in DNA pair? How do you compare a DNA molecule to a zipper?…

A: According to the question, we have to give a solution on the nucleotides in the DNA pair and in…

Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the…

A: The method of identifying the nucleotide code - the sequence of base sequence – is known as DNA…

Q: AKS 5c1: A section of a nucleic acid is shown in the model below. The process represented in the…

A: Nucleic acids are one of the most important biomolecules of living system. There are two types of…

Q: 1. What is the difference between an iterated blast (psi-blast) search and a simple blast search? 2.…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: X EXTRA CREDIT! The Ebola virus contains a genome made up of single- stranded RNA. RNA extracted…

A: Ebola is a virus of the family Filoviridae, genus Ebolavirus.

Q: Which lane shows the DNA fragment completely digested with Pst n

A: Restriction endonuclease are the enzymes which cleave the DNA at specific sites Various sites are…

Q: 1. Fill in the parent and template strands of DNA below. Next transcribe the RNA from the template…

Question

For this oligonucleotide,

• Classify if RNA or DNA? Justify your choice.

• Determine the sequence of this segment, labeling the 5’ and 3’ ends.

O=P-OCH
N
OH
O=P-OCH
0=р
0
HN
0
0
ОН
= P —OCH,
0-
NH
н
ОН
NH₂
N
OH
NH,

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Understanding what is oligonucleotide

VIEW

Step 2: 1. Classifying whether DNA or RNA

VIEW

Step 3: Determining the sequence

VIEW

Solution

VIEW

Step by step

Solved in 4 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Answer this asap just have 5 mins question 12 and 13 just tell abcdef
I need help with this biology homework question.
The diagram below shows a nucleotide with a [Select] [Select] sugar. ✓ base and a • Which arrow points to the 5' carbon of the sugar? [Select] • A polymerase adding this nucleotide to a newly synthesized strand would create one [Select] bond at what arrow? [ [Select] • In dideoxy sequencing, the dideoxy nucleotides are different because they have [Select] on the carbon labeled with arrow number [Select] 6 5 7 8 9 NH₂ 3 4 2 1
PLEASE DRAW thank you!!1
Translate the following opposite strand of DNA based on the nucleotide bases. ATTGACTGG
#1: 3’ T A C A T G C C G A A T G C C 5’ #2: 3' T A C T G G C A T A A C A C T 5' determine the following Partner DNA strand - the mRNA strand - the tRNA - the formed amino acids- the discussion of the entire procedure -
Pls help ASAP! (Options are True or False for all drop down options)
How would you calculate the amplicon in DNA!
384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write answers in your own words (don't copy the answers directly) Choose one of the questions below to write a follow-up question Structure and Function of DNA and RNA Q2.1- Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single stranded conformation. Considering that the double helix is the most stable conformation in water, how does this observation support the conclusion that base stacking contributes more to helix stability than interbase hydrogen bonding? Amino Acids and Peptides Q2.2-Using Table 4.3, list the amino acids that will carry a net charge at pH 7 within a protein. What is the charge at pH 7 for each of the amino acids you have listed (-2, -1, +1, etc.)? What is the net charge at pH 7 of the tetrapeptide shown in figure 4.17?
I need help with this homework biology question.
Compute the A+C:T or U ratios of your DNA and RNA models. Do you expect the same values for DNA and RNA? Why or why not? DNA: 5' ATGGCCTGAG 3' 3' TACCGGACTC 5' RNA: 5' AUGGCCUGAG 3'