23. Consider the double stranded template DNA (The top strand 5' end is on the left) and two primers (Primer 1 and 2). Each primer is 15 nt in length. Primer 1 hybridizes to the bottom strand at the position highlighted in bold. Primer 2 hybridizes to the top strain (in bold). Galle 3 5` CCTAATCCGATCCCGACAGTTTTGCTCCATG|ATCCGATCGACCTCGŁGAG 3` V GOATTAGGCTAGGGCTETCAAAACGAGGTACTTAGGCTAGCTGGAGCGCTC 15 bp in length Primer 1: 5'TAATCCGATCCCGAC 3' Primer 2: 5'CGAGGTCGATCGGAT 3' primer 2 a. If this DNA is used in a PCR reaction, how long will the amplicon be? Input a number 45 (bp) allegos b. What is the first nucleotide added by DNA polymerase to Primer 2? Input a nucleotide base (G, A, T or C)____G

Q: how many codons would exist in a genetic code that was four bases long (instead of three)

A: DNA consists of four different bases, and the codon is four bases long. So, there will. be 44 number…

Q: The BamH1 enzyme comes at a concentration of 100,000 U/ml. You are asked to digest 20 ug of DNA with…

A: The term "specific activity" describes the amount of an enzyme's enzymatic activity that is produced…

Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…

Q: Why is deleting one nucleotide generally more detrimental than deleting three?

A: Nucleotides are monomeric units of nucleic acids.They are phosphate esters of nucleosides and made…

Q: ents the biochemical reaction that occurs durin

A: Introduction:-  DNA synthesis is the biological process by which a deoxyribonucleic acid(DNA)…

Q: Take two pieces of string that are each approximately 10 inches long, and create a double helix by…

A: As given in the question, two pieces of 10 inches long string are wrapped around each other in a…

Q: What is Simple sequence repeat?

A: The genome of every individual contains millions of genetic variation or variants which make each…

Q: X-ray was used by Rosalind Franklin and Maurice Wilkins to study the molecular structure of DNA. Why…

A: Rosalind franklin and Maurice Wilkins used the X-ray diffraction method to determine the structure…

Q: In sequencing, dideoxyribonucleotides (ddNTP) are used that terminate the amplification. Why do they…

A: Introduction : DNA sequencing is the process by which the specific sequence of the four nucleotide…

Q: What does a deoxy nucleotide do when it gets incorporated any newly synthesize DNA and why? Where do…

A: DNA or deoxyribonucleic acid is the genetic material of most living organisms except for certain…

Q: As a result of the Human Genome Project, we learned that approximately % of "junk" DNA is actually…

A:

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…

Q: What is the role of alcohol in extracting DNA?

A: DNA (Deoxy Ribonucelic Acid) extraction is carried out to perform experiments. The first…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…

Q: What are degenerate primers? Name two uses for degenerate primers.

A: Introduction  A primer is a small sequence of nucleic acids that serves as the precursor to DNA…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: How many comparisons are needed to count the number of duplicates in a list? How many comparisons…

A: Codons are triplets of nucleotides (4 types of nucleotides, A, U, G, C) found on mRNA sequence which…

Q: Number of hydrogen bonds that form between U and A in a Watson-Crick base pair interactions?a) 0b)…

A: Deoxyribonucleic acid (DNA) is a double helical structure, which is composed of nucleotides. The two…

Q: If you worked backward, starting with the amino acid sequence of the protein, would you obtain the…

A: The fundamental tenet of molecular biology is the idea that genetic material can only move from DNA…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…