384Answer all the questions below please!Required:At least 3-4 sentences for each answerWrite answers in your own words (don't copy theanswers directly)Choose one of the questions below to write afollow-up questionStructure and Function of DNA and RNAQ2.1- Hydrogen bonds can form with bases on the opposite DNA strandsin the double helix, or between the bases and H2O in the single strandedconformation. Considering that the double helix is the most stableconformation in water, how does this observation support the conclusionthat base stacking contributes more to helix stability than interbasehydrogen bonding?Amino Acids and PeptidesQ2.2-Using Table 4.3, list the amino acids that will carry a net charge atpH 7 within a protein. What is the charge at pH 7 for each of the aminoacids you have listed (-2, -1, +1, etc.)? What is the net charge at pH 7 ofthe tetrapeptide shown in figure 4.17?

Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Answered: 384 Answer all the questions below…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter11: Structure Of Nucleic Acids

Section: Chapter Questions

Problem 20P

See similar textbooks

Similar questions

Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Helical Parameters I A 41.5-nm-long duplex DNA molecule in the B conformation adopts the A-conformation upon dehydration. How long is it now? What is its approximate number of base pairs?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. DNA Supercoiling Parameters A â€œrelaxed,â€� circular, double-stranded DNA molecule (1600 bp) is in a solution where conditions favor 10 bp per turn. What is the value of L0 for this DNA molecule? Suppose DNA gyrase introduces 12 negative supercoils into this molecule. What are the values of L, W, and T now? What is the superhelical density, ?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Supercoiling Parameters Suppose one double helical turn of a superhelical DNA molecule changes conformation from B- to Z-form. What are the changes in L, W, and T? Why do you suppose the transition of DNA from B- to Z-form is favored by negative supercoiling?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the â€œsense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5â€™-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5â€™ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identifying DNA Structural and Functional Elements from Nucleotide Sequence Information Listed below are four DNA sequences. Which one contains a type-II restriction endonuclease (six-cutter) hexanucleotide site?. Which one is likely to form a cruciform structure? Which one is likely to be found in Z-DNA? Which one represents the 5'-end of a tRNA gene? Which one is most likely to be found in a triplex DNA structure? a. CGCGCGCCGCGCACGCGCTCGCGCGCCGC b. GAACGTCGTATTCCCGTACGACGTTC c. CAGGTCTCTCTCTCTCTCTCTC d. TGGTGCGAATTCTGTGGAT e. ATCGGAATTCATCG
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Solving the Sequence of an Oligopeptide From Sequence AnalysisData An octapcptide consisting of 2 Gly, 1 Lys, 1 Met, I Pro, I Arg, 1 Trp, and 1 Tyr was subjected to sequence studies. The following was found: Edman degradation yielded Upon treatment with carboxypeptidases A. B, and Y, only carboxypeptidase Y had any effect. Trypsin treatment gave two tripeptides and a dipeptide. Chymotrypsin treatment gave two tripeplides and a dipeptide. Acid hydrolysis of the dipeptide yielded only Gly. Cyanogen bromide treatment yielded two tetrapeptides. Closlripain treatment gave a pentapeptide and a tripeptide. What is the amino acid sequence of this octapeptide?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Structural complementarity is the key to molecular recognition, a lesson learned in Chapter 1. The principle of structural complementarity is relevant to answering problems 5, 6, 7,11, 12, and 19. The quintessential example of structural complementarity in all of biology is the DNA double helix. What features of the DNA double helix exemplify structural complementarity?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculate the Number of Nucleosomes in a Human Diploid Cell Assume that there is one nucleosome for every 200 bp of eukaryotic DNA. How many nucleosomes are there in a diploid human cell? Nucleosomes in be approximated a disks 11 nm in diameter and 6 nm long. If all the DNA molecules in a diploid human cell are in the B-conformation, what is the sum of their lengths? If this DNA is now arrayed on nucleosomes in the beads-on-a-string motif, what would be the approximate total height of the nucleosome column if these disks were stacked atop one another?
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Protein-DNA Interactions Gerie expression is controlled through the interaction of proteins with specific nucleotide sequences in double stranded DNA. List the kinds of noncovalent interactions that might take place between a protein and DNA. How do you suppose a particular protein might specifically interact with a particular nucleotide sequence in DNA'.â€™ That is. how might proteins recognize specific base sequences within the double helix?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Essentials of Pharmacology for Health Professions

Nursing

ISBN:

9781305441620

Author:

WOODROW

Publisher:

Cengage

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Essentials of Pharmacology for Health Professions

Nursing

ISBN:

9781305441620

Author:

WOODROW

Publisher:

Cengage

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Comprehensive Medical Terminology

Nursing

ISBN:

9781133478850

Author:

Jones

Publisher:

Cengage

Nutrition Now

Health & Nutrition

ISBN:

9781337415408

Author:

Brown

Publisher:

Cengage

Medical Terminology for Health Professions, Spira…

Health & Nutrition

ISBN:

9781305634350

Author:

Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS