e. You also study the expression of 2 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTCТАТGCGCTACТАТААTGACCATTATАССССТАСGTGATAG...5" promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). 40 оо

Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'

A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: During mutation, there is a change in the overall sequence of the gene, which can result in a change…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: +1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a…

A: A base pair is two nucleotides that together constitute DNA ladder." A DNA nucleotide is composed of…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: A mutation is a change in the sequence of the DNA that may affect the codons of the DNA or mRNA.…

Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: D. A null mutation in the smarty gene results in no functional SMARTY protein produced. nottulum…

A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…

Q: Biology Question

A: The process of making the copy of DNA is termed as replication. The central dogma describes the flow…

Q: Given the following genetic network of a putative clock- controlled genes network that are regulated…

A: RNA Binding Proteins:  RBPs (RNA-binding proteins) are proteins that bind to double or single…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: in 3 5% Shown below is a schematic diagram showing a 3000 bp region of yeast genomic DNA. (Note:…

A: DNA:  The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…

Q: An EMS mutagenesis screen identified several mutants in this gene. The figure shows the position of…

A: "As per the Q&A guidelines, we will provide the solution to the first question. Please repost…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: You are studying the regulation of the enzyme 3-phosphoglycerate dehydrogenase (3PGD). This is the…

A: Serine is a non-essential amino acid that means it is produced by our body. It is present in almost…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the formation of protein from the mRNA in the cytoplasm.

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.