Draw ADAMS Consensus trees (a) A A B (0) C D DEFG E F G 11 D [b] (d) tree for E A 8 f for 4 ын B fa

Q: MATCH each of the following terms to a structure from the list below. There is only one correct…

A: Hope you understand...... Please do rate..... Thankyou :)  Have a good day ..

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: plz explain with thorough explanation

A: ANSWER;- In this image, B is correct. Explanation- Because the given probs bind with telomeric…

Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…

A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…

Q: 2. Design a primer pair using NCBI Primer-BLAST for gene RNA 2',3'-cyclic phosphate and 5'- OH…

A: Forward primer:A primer that binds to antisense or plus strand of DNA is called as forward…

Q: 1. You are required to use the pET 28b expression vector in a cloning experiment. If the vector is…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: WACE: Sanger Sequencing Sequencing the DNA of a person who is heterozygous for an allele Sequencing…

A:

Q: Define the planted motif search problem.

A: INTRODUCTION : A sequence motif - This sequence motif is a nucleotide or amino acid sequence pattern…

Q: You discover a new gene cluster from a strain of the bacterium Streptomyces. The domains of the…

A: Polyketides(PKs) and non-ribosomal peptide hybrids(NRPS) are important class of natural products,…

Q: Homology modelling involves O Alignment of the target sequence to the sequence of a template…

A: In the context of evolution, homology refers to shared ancestry. Proteins which two organisms have…

Q: 5'.....GATTGCAT.....3' Which molecule below will hybridize to your sequence of interest? Why? A) 5'…

A: The question is inquiring about the method of DNA hybridization, which is a crucial concept in…

Q: If you have the following proteins? Protein MW, kDa 67 pl 3.5 A В 45 7.3 C D 45 5.0 14.5 7.3 E 67…

A: Proteins B and D have the same PI. However there is a considerable difference in the size of these…

Q: Which forward are reverse primers will amplify the following sequence by PCR?…

A: As given in the question, forward and reverse primer sequences are to be identified to amplify the…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: Nucleotide Site 3 4 9. 10 Outgroup C G Sislaf rose C G G C G т C T Glozzom rose G G G A Pentwist…

A: Taxon on a tree A phylogeny, or evolutionary tree, represents the evolutionary relationships among a…

Q: 4.08 ¡Î1.02↑ E E 2.54 H H 1.02 Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H =…

A: An RNA transcript or the DNA encoding its introns are non-coding segments that are spliced off…

Q: 1. Let s and s' be two sequences, where s= GGATT and s' evolves from s by substituting the A in s by…

A: The DNA is present in a double helix sequence, which has two strands present in complementary to…

Q: Looking at the sequence of gene X, you hypothesize that there is an intrinsic terminator in the 3'…

A: Blot A shows a band for both the wild-type and IT gene, indicating that the ΔIT gene is still…

Q: . What steps might be taken to minimize atrophy of theskeletal muscles in patients confined to bed…

A: The soft tissue-like structure found in the majority of the animals including human beings is known…

Q: QUESTION 16 1. Which of these traits is NOT shared by vertebrates and cephalochordates? Structural…

A: Cephalochordata is a group of marine animals having fish-like elongated bodies. The body is provided…

Q: What is a haplotype?

A: Single base pair changes in the DNA sequence such as deletions, insertions between two human genomes…

Q: Construct the following: 6. 5’ dADP 7. 5’ UTP 8. G to C base pairing

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Explain the connection between the founder and the G8-C marker.

A: In this example the original mutation that caused  the huntington allele occurred in a germline cell…

Q: 4) Consider three different kinds of human libraries: a genomic library, a brain cDNA library, and a…

A: Genomic deoxyribonucleic acid (gDNA) is representative of the chromosomal DNA present in the cells…

Q: Out of the 4 base pairs that are shown, B and C are the ONLY Watson-Crick base pairs that are found…

A: The four bases that make up DNA are adenine (A), cytosine (C), guanine (G), and thymine (T), while…

Q: If your analysis identifies that the total Cytosine content in a sample is 29%, what will be the…

A: According to Chargaff's rule number of purine(adenine+guanine) = number of pyrimidine (cytosine +…

Q: 4. The bars in the following sequence indicate the break 5'-CGGGTAТСТАСТААА| TTCGCACTТАCGAGGAТТААСАТ…

A: Introduction : Primers are small, chemically synthesised oligonucleotides that are complementary to…

Q: In bact

A: Choose the correct answer.

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: 3kb 2.7kb 5.3kb 1kb A C D

A: DNA has been cut with restriction enzymes. Restriction enzyme cut at the specific base sequence…

Q: Strain W Strain X Strain Y Strain V Strain Z Under these conditions, rank cterial strains from most…

A: In competitive dominance hierarchy diagrams, the arrow suggests that the pointed species is more…

Q: Q - Can you write one sequence of 15 nucleotides that can be produced using this transformational…

A: In this question, we need to find one sequence of 15 nucleotides from the given transformational…

Q: When running a gel during a Sanger sequencing, the following results were obtained: I I Find the DNA…

A: Sanger sequencing is a technique which is used to determine the order of the four nucleotide bases…

Q: quence is an intrinsic terminator). wild-type ΔΙΤ A Blot B Blot D Blot E Blot A Blot C wild-type ΔΙΤ…

A: The above image is of Northern blotting which shows separation of RNA on the gel. The gel used in…

Q: 8. Given the following two sequences, create a pairwise alignment by hand. Do not place any gaps in…

A: Introduction :- When the cell needs energy, ATP can be taken out and used to fuel processes or…

Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…

A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…

Q: Based on base substitution rates, which of the following is likely to be true? P(A/G) + P(A/T)…

A: In molecular biology, base substitution mutations are classified into two main…

Q: 11. Match each of the figures above to each item below and determine the each figure Stage above E D…

A: Introduction

Q: Which of these sequences has dyad symmetry? O 5' AATGCTTATCGTAA 3' O More than one of the above O 5'…

A: Dyad symmetry refers to two areas of a DNA strand whose base pair sequences are invertead repeats of…

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: The sequence of nucleotides that complement codons is known as an anticodon. They are found in tRNAs…

Q: Based on the figure, discuss about the psbA gene in the Oryza sativa chloroplast genome.

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: List and describe the steps that make up the central dogma of molecular Biology. This means, how the…

A: DNA(deoxyribonucleic acid) is a molecule comprised of two polypeptide chains that coil around each…

Q: Looking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the…

A: Restriction fragment length polymorphism (RFLP) is a type of polymorphism that results from…

Q: |Sample D| (A) after RNase Pedestal Type DA 50 00 Conc 323. ngl A260 (10 mm pa) A80 (10 mm pah) 6476…

A: Rna is a nucleic acid which is transcribed from DNA. These rna molecules form secondary structures…

Q: Why do you suppose that forensic DNA analysis relies principally onshort tandem repeats (repeat…

A: DNA analysis is the method by which the DNA of any individual is analyzed to ascertain that whether…

Q: The phosphates that make up the phosphodiester bonds in DNA have pka 2. The genome of the blue crab…

A: pH is a measure of the acidity or basicity of a solution. It is defined as the negative logarithm of…

Q: 5' 3' ORF for gene X +1 ou find a mutation elsewhere in the genome (not within the sequence above)…

A: The genetic information encoded in DNA is transformed into a complementary RNA molecule during the…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.