DNA message #2: GAG-CGC-ACC-ATC-ACT-ATC-ATT Transcription to mRNA: CUC GCG UGG UAG UGA UAG UAA Translation of codons to Amino Acids: What is the Clue?

Q: 3' AAAACTGTGCAT5'

A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…

A: DNA replication being very complex process, there are chances of miss reading the DNA template and…

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?

A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase III III E - A compound with no electrical…

A: Chaperones are proteins that aid in the folding, assembly, and stabilisation of other proteins in…

Q: The type of RNA modification that requires guide RNAs is ________.

A: Hi, Thanks For Your Question.  Answer : Correct Answer Is RNA Editing Explanation : RNA Editing Is…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…

A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…

Q: In human, translation begins before transcription of an mRNA completes. T/F

A: The central dogma of molecular biology states that exciting DNA molecule in the cell undergoes…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: The codon is found on mRNA? True or False?

A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…

Q: GENE TABLE 1: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA GAA CAG GTG GTT CCA AAG…

A: The central dogma of life involves the following three steps. Replication: DNA replicates to make…

Q: Where does the process of transcription start on the strand of DNA?____        Where does the…

A: Transcription is that the process of creating an RNA copy of a gene sequence. This copy, called a…

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…

A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…

Q: Do not use Ai

A: source: Internet (to make understand the concept)

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would…

A: The objective of the question is to determine the sequence of amino acids that would result from the…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: hange the peptide to Met Asp Asn Gly Leu Gly ?    Use the codon numbers to help describe where the…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: 17) Codons are three-base sequences in mRNA that specify the addition of a single amino acid to the…

A: 17) Correct answer is option d(codon are a nearly universal language among all organisms) because…

Q: What amino acid sequence does this RNA sequence code for? ACU GAG AGC ACG

A: Introduction In reality, transcription and translation are the two processes that make up this…

Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…

A: Please follow step 2 for detailed explanation.

Q: SARS E You have generated several random mutations in this region. One of them is -…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: Only answer please, no need to explain… Thank you for your time. i:  Modification of the 5 prime…

A: Answers :  i) capping    ii) all of these    iii) transcription

Q: Complete the following tables: CODE: T-A-C A-T-G C-C-G T-G-G A-A-T C-G-C A-T-T CODON: ANTICODON:…

A: Protein synthesis consists of two main steps - transcription and translation. During the process of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.