Describe with the aid of appropriate diagrams what techniques could be used to analyse: (a) expression levels of the Epidermal Growth Factor Receptor tyrosine kinase (EGFR) MRNA; (b) any mutations that mRNA is carrying.

Q: The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…

A: A precursor mRNA (pre-mRNA) is a type of primary transcript that becomes a messenger RNA (mRNA)…

Q: Cancers are often caused by overactive growth factor receptor signaling (remember growth factor…

A: Cancer is a disease which is caused by the uncontrolled growth of the cells, without regulation of…

Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'

A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…

Q: Through recombinant DNA methods, a modified steroid hormone receptor was prepared that consists of…

A: The ligand-binding domain can be defined as the type of domain that allows the binding of the…

Q: Which of the following would you expect to happen if there were a mutation in the Iron Response…

A: Sequences of mRNA called called (IREs) are contained within the mRNA sequences that code for…

Q: the main characteristics of genetically encoded calcium indicators: (can be more then one answer)…

A: Main characteristics of Genetically encoded calcium indicators (GECI) are-

Q: O both rhodopsin action and gene expression dependent on retinal O retinoic acid-mediated vision,…

A: Vitamin A  is a fat-soluble vitamin, which initially exists as retinol, retinal or retinoic acid.…

Q: please write one paragraph or 3-4 lines  on background information regarding Gene Cloning &…

A: Epidermal growth factor receptor (EGFR) is a transmembrane receptor protein that plays a crucial…

Q: To create a functional hormone, insulin pre-mRNA is first made during the process of transcription…

A: Proteins are one of most abundant molecules with organic in nature in the living organisms and…

Q: The transcription factor Pax6 is required continually during the life of a mouse (or a human) for…

A: Pax6 is a kind of transcription factor which is required for the development of retina in mouse and…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Based on the labels you should be able to recognize the characteristic structure depicted below and…

A: Introduction The Process Of Turning Nucleic Acid Information Into Amino Acids Is Known As…

Q: You are working with a fly hair cell developmental system. This Notch/Delta-regulated system results…

A: The cells undergo cell division and differentiation so as to form different types of cells. The…

Q: stem cells undergo the fate decision process before developing into tissues or organs. This process…

A: A concept map is a map which tells us about diagrammatic relationship between concepts and helps us…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the formation of protein from the mRNA in the cytoplasm.

Q: Vitamin A's two best studied forms and functions are both rhodopsin action and gene expression…

A: Vitamin A is a fat soluble vitamin. This vitamin can be reversibly converted to the aldehyde…

Q: In which tissue(s) is the mRNA and protein highly expressed in? 1. Go to:…

A: As instructed in the above question steps were followed and tissue expression in terms of protein…

Cell Signaling

It allows cells to perform various cellular activities, coordinate, and interact with other cells. All cells of an organism receive signals from their environments and respond accordingly. Even the unicellular eukaryotes receive signals secreted by other cells and respond. In the case of yeast, mating takes place by signaling between the yeast cells. Communication by cell signaling in a multicellular organism has become a vast and important part of various fields of biology.