Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for delivering into human cells.

Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
icon
Related questions
icon
Concept explainers
Question
Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for delivering into human cells.
Expert Solution
Step 1

Explanation:

A plasmid is a circular piece of DNA that will be utilized in the process of inserting a gene into human cells. This gene is included inside the plasmid that will be used. The plasmid also has a promoter in it, which will assist in controlling the amount of the gene that is expressed. A procedure known as transfection will be used in order to introduce the plasmid into human cells. In the procedure known as transfection, the plasmid may be delivered into the cell by the action of a virus or through the use of a needle.

 

A procedure known as transfection will be used in order to introduce the plasmid into human cells. In the procedure known as transfection, the plasmid may be delivered into the cell by the action of a virus or through the use of a needle.

 

The gene of interest is included inside the plasmid that will be utilized, which is a circular piece of DNA that is double-stranded. This plasmid has to be modified such that it contains a promoter region that will allow the gene of interest to be expressed in human cells. This may be done via genetic engineering. It is also expected that the plasmid will include a selectable flag gene, which will make it possible to choose between cells that have successfully taken up the plasmid and those that have not. A process known as transfection will be used in order to introduce the plasmid into human cells. There are many other approaches that may be used to achieve transfection, but the one that is utilized the most often is the introduction of a chemical or physical substance into the cell membrane in order to induce the formation of holes. These pores allow the plasmid to enter the cell. When the plasmid is finally inside the cell, the machinery of the cell will pick it up, and the gene of interest will be expressed.

 

The gene of interest must first be extracted before it can be included in the construction of a plasmid that is suitable for use in human cells. The use of restriction enzymes to cut the DNA at certain sequences is the most frequent approach for achieving this goal; however, there are many other ways that this may be done. Following this step, the gene of interest is separated from the rest of the DNA and then placed into the plasmid. Following this step, the plasmid is cut using the same restriction enzymes, and the gene of interest is then put into the plasmid. After that, the plasmid is cleaned up to the point where it is ready to be introduced into human cells.

 

In order to introduce the plasmid into human cells, one may use any one of a number of different approaches. The most typical method involves the introduction of a chemical or physical substance into the cell in order to produce holes in the cell membrane. These pores allow the plasmid to enter the cell. When the plasmid is finally inside the cell, the machinery of the cell will pick it up, and the gene of interest will be expressed.

 

steps

Step by step

Solved in 2 steps

Blurred answer
Knowledge Booster
Bacterial genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education