Choose the statement below that is true about the characteristics of the bacterial fertility factor factor. O The fertility factor carries genes responsible for uptake of naked DNA, and has several IS elements to assist plasmid integration into host cell's chromosome. The fertility factor carries genes responsible for formation of bacteriophages, and has several IS elements to assist plasmid transfer through the sex pilus. O The fertlity factor carries genes responsible for formation of sex pili, and has several IS elements to assist plasmid integration into host cell's chromosome. The fertility factor carries genes responsible for formation of sex pili, and has several IS elements to assist plasmid transfer through the sex pilus.

Q: What removes the Lacl repressor protein so the gene of interest in a plasmid can be induced to be…

A: The lac operon refers to the region present in the DNA of E.coli. It comprises three genes that…

Q: Certain environmental conditions such as exposure to UV light areknown to activate lysogenic λ…

A: Lambda (λ) phage is a bacterial virus, or bacteriophage, which infects the bacterium Escherichia…

Q: Pegard to bacteriophage lambda's decision to enter the lytic or lysogenic cycle, which of following…

A: INTRODUCTION A bacteriophage, or phage for brief , is a virus that infects bacteria. Like other…

Q: Explain why penicillin therapy may result in the formation of Lforms but tetracycline therapy would…

A: L forms are those bacteria that have lost their cell wall due to certain drug (penicillin) or enzyme…

Q: Which of the following properties make Ti plasmid an appropriate vector? I. to include T DNA II. to…

A: Answer: Ti-plasmid : It is the tumor inducing plasmid found in the pathogenic species of…

Q: How would a technique of using the luciferase plasmid be to verify that the estrogen receptor was…

A: Tamoxifen is defined as the hormone therapy for "breast cancer " in both men and women. Sometimes,…

Q: Although many +ssRNA viruses use their genomr directly as mRNA retroviruses do not. instead their…

A: Retroviruses have a very unique mechanism . They are single stranded RNA viruses, instead of using…

Q: 1. Determine what is being meant by the statements: a. What is a binary vector? What characteristic…

A: A vector is a DNA molecule that is used in molecular cloning to intentionally transport foreign…

Q: The figure provided portrays the integration of Lambda phage into a host chromosome at the att site,…

A: In order to determine the change of the host bacterium status from gal- to gal +, the galactose…

Q: Name the commonly used vector for trans formation in plant cell?

A: Transgenic crops are those crops that have been genetically modified (GM) to support our needs. The…

Q: Explain in molecular terms how a bacterial cell is made lysogenic by a temperate phage such a lambda

A: Introduction :- Lysogeny is the process in which a temperate phage, such as lambda, infects a…

Q: Describe the role that integrase plays during the insertion of λDNA into the host chromosome.

A: Integrase is a viral enzyme that catalyzes the integration of virally derived DNA into host cell…

Q: Flavr savr Tomato Golden rice, Roundup ready soyabean In order to generate GM foods mentioned above,…

A: Genetically modified food are produced by the manipulation of genome of the plants or organism…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: For Figure 15-7, draw out a series of steps that could explain the origin of this large plasmid…

A: We need to provide the process leading to the origin of a large plasmid containing various…

Q: Agrobacterium tumefaciens contains ------ plasmid inducing tumor in plants. Which of the following…

A: Agrobacterium tumefaciens is a bacteria which belongs to family Rizobiaceae.it is a rod shaped gram…

Q: 1. In terms of Spo11, what does it mean if twice as many genetic sequence reads map to one location…

A: The procedure, which keeps a proper haploid set of chromosomes in the germ cell, depends on the…

Q: Human Papillomaviruses has of many strains. Some of them cause warts while others can cause cancer.…

A: *Human papillomaviruses are type of viruses that causes abnormal tissue growth and cause other…

Q: The following are lambda phage gene deletions. What lambda lifestyle will result from each deletion?…

A: Lambda phage is a enterobacteria phage that is responsible for E.coli infection   It has a double…

Q: Jm109 cells transformed with ligation and plasmid alone is used. The colonies most like:   white…

A: β-galactosidase is an enzyme encoded by the lacZ gene and is used to break down lactose to glucose…

Q: Agraobacterium mediated transformation is a useful gene transfer technique but still we can’t use…

A: Agrobacterium species harboring tumor-inducing (Ti) or hairy root-inducing (Ri) plasmids cause crown…

Q: E. coli

A: Bacterial Strain LE392 is used for both genomic and cDNA cloning. LE392 lacks the E. coli K…

Q: there

A: The corona virus is a SARS-CoV2 virus is transmitted through the viral droplets which get released…

Q: Please select all cellular processes that do NOT rely on RecA protein function as far as we…

A: RecA is a 38kDa recombinase protein found in prokaryotes and is essential for the maintenance,…

Q: Before the integration of a transposon, its transposasemakes a staggered cut in the host target DNA.…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: Briefly describe the differences between the lytic cycle of virulent phages and the lysogenic cycle…

A: Bacteriophages (phages) are obligate intracellular viruses that specifically infect bacteria. The…

Q: The NDM gene is usually plasmid-bourne. What are the implications of this?

A: NDM1 is an enzyme that is used by the bacteria to make itself resistant to the wide range of beta…

Q: Describe the Ti plasmid binary vector system used in plant transformation and provide details of how…

A: Plasmids are small circular double-stranded DNA molecules present in bacterial cells and other…

Q: E. coli cells are simultaneously infected with two strains of phage λ. One strain has a mutant host…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: Is the genus alcaligenes gelatin negative or postive?

A: Prokaryotes are single-celled microscopic organisms belongs to the domain bacteria. A prokaryotic…

Q: Ti Vector Plasmid Hfr HIV Bacteriophage

A: Introduction: In molecular biology, a vector is a DNA molecule (usually plasmid or virus) that is…

Q: You are studying a group of individuals with X-ray vision and perform linkage analysis and note that…

A: DNA cloning is the procedure in genetic engineering used for the production of a larger number of…

Q: Please explain how alternative gene expression is mediated by a recombination process in Salmonella?…

A: Gene expression is the method by that info from a gene is used within the synthesis of a functional…

Q: Describe how you would genetically design a superbugresistant to b-lactams, methicillin,…

A: Superbugs are strains of viruses, bacteria, fungi, and parasites that are resistant to most the…

Q: Understanding the life cycle of Plasmodium is important and we know that it is spread via mosquitos.…

A: Disclaimer: As per Bartleby guidelines, we will answer only the first question. Please repost the…

Q: Describe any three vectors less method of introducing the rDNA into a competent host cell?

A: rDNA is the recombinant DNA which is formed by combining desired genes from different organisms. It…

Q: Write in detail about the effects of presence as well as absence of MCS and reporter gene in a…

A: MCS (Multiple Cloning Sites ) -- Multiple cloning site is region of D.N.A. with in a plasmid that…

Q: explain F' plasmid transfer diagramatically

A: The F plasmid carries genes for synthesizing proteins that can create connections between donor and…

Q: draw structure of plasmid

A: The plasmid is the extrachromosomal deoxyribonucleic acid (DNA) that is present with the bacterial…

Q: Describe the genetic makeup of a plasmid in an F’ cell, including the types and origins of genetic…

A: Plasmids are DNA molecules that exist outside of the chromosomes. They are microscopic, round, and…

Q: Several new genes in the SOS regulon were identified by an ingen- ious use of “Mud" phages. These…

A: SOS it is a DNA repair system.

Q: Describe the generation of the mutiple drug resistance plasmids?

A: Drug resistance is defined as a reduction in the effectiveness of drugs, chemicals, and other…

Q: Examine the pTrcHis expression vector from Invitrogen. What is lacI q ? Why is it found on the…

A: In a molecular cloning method, a vector can be referred to as any vehicle, most often a plasmid,…

Q: A bacterial cell receives a new gene contained on a plasmid exchanged through the formation of a sex…

A:

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.