Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?

Q: None

A: Changes in DNA sequence: This option is correct because epigenetic changes do not involve…

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…

A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…

Q: 1. How are DNA and RNA different from each other? (Select all that apply.) * RNA is more stable than…

A: Planet's life is extremely varied, ranging from simple single-celled protozoa to intricate…

Q: Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms…

A: The correct matching of proteins with their functions in DNA replication:Unwinds DNA at replication…

Q: If a piece of the template strand of DNA has the sequence 5’- ACG.ACC.GCC.GGT -3’ and it is…

A: Codon is a group of three bases in mRNA. Each codon specifies an amino acid.

Q: Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA,…

A: DNA polymerase DNA is replicated by enzymes known as DNA directed DNA polymerases or simply DNA…

Q: What type of nucleic acid is this diagram? Rna or Dna  and what molecule will bind to thymine in…

A: Nucleic acid are structure that are important to cell as they carry genetic information within them.…

Q: DNA replication Using the labels below, assign them to the appropriate parts of the diagram.

A:

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: What is the nucleotide sequence of the complementary strand of this molecule AT GCGA? O CATAG O A AT…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are well known and well defined as the two…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Write the complementary sequence of DNA AGCTAT AGC

A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: Introduction  A polynucleotide consisits of many nucleotide monomers. DNA is made up of…

Q: Indicate where each of the following processes occurs (nucleus, cytoplasm or mitochondria).…

A: In humans, the genetic information present in the cell is in the form of the Deoxyribose Nucleic…

Q: 36/ In the figure representing DNA replication represents the leading strand? AA C.C DD None of the…

A: DNA replication means making a replica or copy of the DNA strands. DNA is a double-stranded…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: dna stored at physiological ph is negative charge  single strand  positive charge  unchanged…

A: The DNA deoxyribonucleic acid is the genetic material in almost all organisms except in case of few…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.