ASsume that a fish inherits a mutation in both the eye switch and the coding region of the Pitx1 gene. You isolate DNA from the jaw, pelvis, eye, and pituitary tissues. In which tissue(s) would you expect to see functional Pitx1 protein? Jaw Pelvis Activator 1 Activator 2 Pary Jow swch Pevc sch Phutory Jow Pevic swkch swich swkch Pitxt Pitx1 Eye 41 Pituitary Acvutor 3 Adivalor 4 Phutary swich Jew wtch Pelvic twch Peutary Jaw Swtch Pelvic Sanch Satch Pixt Pit1 Figure 2 eye only jaw, pelvis, eye, and pituitary no tissues would have a functional protein jaw, pelvis, and pituitary only O O 0 O

Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…

A: 3' TAC TCC GGC TCT CCC AGT TGA ACT 5' The sequence given is 3' to 5' sequence. Let us transcribe it…

Q: The diagram shown represents the coding strand of the myosin gene. Mutations in myosin can lead to…

A: mRNA  The short chain of RNA molecule that is made by the process of transcription. And translated…

Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: WRT is a gene in C. elegans worms which is normally expressed in a specific stage of development.…

A: WRT is a gene in C. elegans which is normally expressed at specific stage of development. a) Several…

Q: a. Explain how you could use worms transformedwith myo-2::GFP to find mutations that disrupt…

A: The alteration of the DNA sequence of the genome in an organism is termed as mutation. It is the…

Q: om college and started working at a biotech startup called Scrofa first job assignment is to clone…

A: Prolactin is defined as a hormone by the pituitary gland at the bottom of the brain. Prolactin…

Q: Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of…

A: Genetic Disorders are disease conditions in the body that occur as a result of gene mutations or…

Q: Use the description of the FGFR3 and your knowledge of protein synthesis to explain how this…

A: FGFR3 stands for fibroblast growth factor receptor 3. It is found in the cell's membrane and sense…

Q: 1. DNA Sequence: TẠC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT…

A: As per our guidelines, we are supposed to answer only one question. Please repost other question in…

Q: afa Q a/a Q Unsupplemented Supplemented b A"/a offspring Unsupplemented mother Supplemented mother…

A: Given information The cross involved is Awa x aa. One group of offspring with supplemented mother…

Q: Read the images given before answering the question below. Identify the two common diseases that…

A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…

Q: Please find the mRNA strand: Amino acid sequence How does the amino acid sequence from the base…

A: BASIC INFORMATION    TRANSLATION  It is the process in which protein is which formed from the…

Q: Give correct typing answer with explanation

A: Cas9Spo11Both1. Functions in defense against bacteriophages - Cas9  - Cas9 is an enzyme that…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Another way to study the role of proteins (e.g., transcription factors) that function in development…

A: Proteins are macromolecules formed by the long chain of amino acids and are the functional product…

Q: A mutation in the coding region of a gene may alter the of the gene. protein-coding region may alter…

A: Mutations are changes in the DNA sequence of an organisms genome. DNA is the genetic material that…

Q: As a hobby you propagate a population of worms. You notice that one worm is now clear instead of…

A: Deletions are mutations in which a section of DNA is lost, or deleted. Since protein-coding DNA is…

Q: A set of nucleotides in an original DNA strand reads: TAC GCG AAT Transcribe this short DNA…

A: Gene is the sequence of nucleotides in a DNA. It encodes a protein.

Q: An EMS mutagenesis screen identified several mutants in this gene. The figure shows the position of…

A: "As per the Q&A guidelines, we will provide the solution to the first question. Please repost…

Q: You are working with a fly hair cell developmental system. This Notch/Delta-regulated system results…

A: The cells undergo cell division and differentiation so as to form different types of cells. The…

Q: How might a point mutation in DNA affect the phenotype. How the genome is expressed in the organism?…

A: The genome of an organism contains all the genetic information required for the development, growth,…

Q: By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human…

A: "Hi, since you have posted more than one question, we will be answering the first two for you.…

Q: O A. Screen thousands of strains for a spontaneous unc-22 mutation O B. Soak worms in mutagenic…

A: In RNA silencing microorganisms are used to silence or negatively affect the gene expression. It is…

Q: why does a clone of cells produceonly one type of G-6-PD enzyme? What would you expect to happen if…

A: Glucose-6-phosphate (G-6-PD) is the enzyme that is involved in the pentose phosphate pathway. They…

Q: If a mutation in a homeotic gene produced the following phenotypes, would you expect it to be a…

A: Mutation refers to the sudden changes that occur in the sequence of DNA’s (deoxyribonucleic acid)…

Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…

A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices.  in…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.