An investigator designed a crRNA to target a gene with sequence GAATGCTATGCTTAGATTAG. Please very how many places in the genome does this sequence target if mismatch number of 2 or less is allowed (assuming DNA bulge and RNA Bulge size is 0)? 2 4 1 3
Q: Which of the following is an example of a primary defense against biotic stress?. Select one:
A: Biotic stress refers to the negative impact of living organisms, such as pathogens, pests, and…
Q: 5 2 4 3
A: Nervous system: It coordinates and controls the activities of animals and organisms. The central…
Q: Valyrians have alleles for gene A, controlling hair color. The dominant A (silver hair) and the…
A: To calculate the frequency of an allele, we need to consider both the homozygous and heterozygous…
Q: need help with both parts pleae
A: The given question states about graphical representation and datas provided for hormonal regulation…
Q: Briefly describe what endosymbiotic theory is. Describe a few ways in which endosymbiotic theory…
A: Prokaryotic cells are simple and small, and their genetic material consists of circular DNA rings…
Q: The Dracula gene makes mice active at night and only consume blood instead of normal food. You…
A: To perform the chi-squared test, we need to set up our null and alternative hypotheses:
Q: A dihybrid cross SS tt x ss TT is used to make an F₁ generation. In the cross the S locus exhibits…
A: Gregor Mendel is regarded as the father of genetics. His experiments with pea plants in the…
Q: 2.2.1 Which gender/sex can be carriers of colour blindness and not have it? (1) 2.2.2 Why does…
A: Pedigrees are of different types. They are : 1. X linked recessive inheritance. 2. X linked…
Q: Order: Decadron 12mg in NS 50 mL to infuse over 30mins
A: This query relates to the administration of Decadron, also known as dexamethasone, to a patient. It…
Q: Lilliputian is a term that comes from Book 1 of Gulliver's Travels. It means ..... inferior…
A: Lemuel Gulliver is the protagonist and narrator of Jonathan Swifts famous novel, "Gulliver's…
Q: Mom has a genotype of Aa Bb and Dad is Aa bb. The A and B genes live on different chromosomes. Draw…
A: Meiosis is a specialized form of cell division that occurs in sexually reproducing organisms. It…
Q: Ten mutant mouse strains with white coats were tested by crossing each with all the other strains.…
A: Complementation usually occur if the mutations are in different genes. Complementation occurs when…
Q: 10. The variable region of an antibody a) Binds to a specific epitope on an antigen. b) Can bind to…
A: Memory cells are a type of immune cell that are involved in the long-term response of the immune…
Q: DATE 5/02/23 Law of Segregation of Alleles: As chromosomes separate into different gametes during…
A: Dihybrid cross involves the mating of individuals with varying traits for two characters. For…
Q: A bacterial strain has a generation time of 30 min, how long would it take an exponentially growing…
A: Bacterial generation time refers to the amount of time it takes for a population of bacteria to…
Q: HACCP plan hazards analysis of yoghurt, list 10 at least Raw Material / Processing Steps HACCP…
A: Hazard Analysis and Critical Control Points (HACCP) plan is a systematic approach to identifying and…
Q: Based on the information provided, which of the following social determinants of health is most…
A: Research or research studies are conducted in a scientifically well-structured way for obtaining a…
Q: Which of the following statements explains what nucleic acids are? Select one: A. Nucleic acids…
A: Understanding the structure and function of nucleic acids is critical in many scientific domains,…
Q: pest control of a yoghurt plant •Identify possible entry point/methods where rats could have…
A: Food packed with rich proteins like almonds, yogurt, cheese and all kind of meats are favorite food…
Q: b) Create three relevant questions that you would like answered or clarified about the role of DNA…
A: In this task, we aim to investigate the part of DNA and chromosomes within the expression of…
Q: Droplet based single cell DNA sequencing uses a microfluidic platform which generates droplets…
A: Single-cell RNA sequencing has recently emerged as a powerful tool for mapping cellular…
Q: In each cell if DNA polymerase I is non-functional, how would it affect the leading strand
A: In prokaryotic organisms, DNA replication is primarily regulated by the enzyme DNA polymerase I. It…
Q: The Mullerian ducts in female mammalian embryos develop into… a) The vas deferens b) The…
A: During embryonic development, the reproductive system goes through a complex differentiation process…
Q: Your dream has come true, you’re a marine biologist studying Narwhals in the arctic. They have been…
A: An aquarium is a closed system, typically made of glass or acrylic, designed to house aquatic plants…
Q: If f(A) = 0.8 and f(a) = 0.2, what is the frequency of Aa if the population is at Hardy- Weinberg…
A: The Hardy-Weinberg equilibrium is a principle in population genetics that describes the relationship…
Q: describe the process of sperm transport to the site of fertilisation and the changes which occur in…
A: Fertilization is the process by which a spermatozoon (sperm cell) fuses with an oocyte (egg cell),…
Q: How do RNA viruses, such as HIV and SARS-CoV-2, achieve high mutation rates and rapid evolution, and…
A: RNA viruses are a type of virus that use RNA as their genetic material instead of DNA. They…
Q: A plant breeder wants to use selective breeding to produce corn with short stalks and a high mass of…
A: Humans employ the technique of selective breeding to pick out specific individuals who possess…
Q: 2. How are T-cells educated in the thymus and B-cells educated in the bone marrow? Discuss the…
A: T-cells and B-cells are both types of lymphocytes that play a crucial role in the adaptive immune…
Q: Numerous enzymes are involved in the process of DNA replication. Select a few of these enzymes…
A: DNA replication is the process by which a cell makes an identical copy of its DNA. During…
Q: The monoamine hypothesis of depression proposes that monoamine oxidase is overproduced in very…
A: Monoamine consists of neurotransmitters which are mainly responsible for behavioral and…
Q: Discuss and explain why these below hazards are the most important
A: 1. Presence of listeria/ Salmonella: Listeria, a foodborne bacteria most likely found in improperly…
Q: How is Sympathetic Afferent feedback carried in the a) upper pelvis?, and in b) the lower pelvis?
A: One of the three components of the autonomic nervous system, which controls bodily processes…
Q: which plant family often has a basal rosette of leaves and a well-developed hypanthium?
A: Plant kingdom is one of five kingdom which comprises of green photosynthetic organisms. It includes…
Q: Parkinson's disease is linked to destruction of the caudate and putamen. extensive death of neurons…
A: Parkinson's disease is a chronic and progressive neurological disorder that affects the central…
Q: Do cells make accurate copies of DNA? Explain with the help of a diagram
A: DNA replication is the process by which a cell makes an identical copy of its DNA. It is a…
Q: People who have been diagnosed with schizophrenia have been found to have differences in brain…
A: Schizophrenia is a chronic and severe mental disorder that affects how a person thinks feels &…
Q: LABEL IDENTIFICATIONS... 1. Fill in the blanks in this overview of photosynthesis in a chloroplast.…
A: Photosynthesis is the process by which algae and green plants use inorganic resources from the…
Q: gea albbiM Obj 29 Identify the specific terms applied to transcription and translation described by…
A: Transcription and translation are two critical processes in the central dogma of molecular biology.…
Q: Will a red blood cell undergo crenation, lysis, or no change in each of the following solutions? a.…
A: Depending on the direction and strength of water transport across the cell membrane, red blood cells…
Q: Seed germination is stimulated by _____; stem elongation is stimulated by ____________ Select one:…
A: Seed germination is the process of events that begin the germination of seed that grows into new…
Q: Starting with a sample of genotype data from N diploid individuals at a locus with two alleles (A1…
A: The conditions that are required to maintain the Hardy-Weinberg equilibrium are: no mutation, no…
Q: If you found the same gene in all organisms you test, what could this suggest about the evolution of…
A: Gene evolution patterns can vary depending on the selective pressures acting on the gene, the rate…
Q: 30*_SP23-General Biology I (for ma A 1:1 phenotypic ratio will occur when which of the following…
A: In this question, we are investigating a hereditary cross between two living beings, centering on…
Q: Flowering plants (angiosperms) Conifers, cycads, Ginkgo gnetophytes (gymnosperms) Ferns & horsetails…
A: Bryophytes are a group of non vascular land plants that includes mosses, liverworts and hornworts.…
Q: Explain the 'Transforming growth factor family' influence on reproduction, giving examples
A: A class of proteins known as the transforming growth factor (TGF) family is involved in many…
Q: Stages Glycolysis Pyruvate oxidation Kreb's Cycle The Electron Transport Chain and Chemiosmosis…
A: This is the first stage of cellular respiration and occurs in the cytoplasm of cells. The reactants…
Q: The dorsal column system crosses to the contralateral side of the nervous system at the level of the…
A: As per the guidelines of BARTLEBY, "Since you have posted multiple questions, we will provide the…
Q: 3. A 60-year-old male patient has a peak expiratory flow rate (PEFR) of 300 liters/minute and a…
A: Peak expiratory flow rate (PEFR) is a useful measurement in assessing lung function, particularly in…
Q: 9. Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately, what…
A: We examine the molecular biology ideas of DNA nucleotide composition, DNA replication, and…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer4.08 H H 1.02 2.54 11.021 E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H = Hindill site H 0.81 EE 1.76 1.10 Fragment sizes are not to scale and all fragment lengths are in kilobase pairs (kbp) Draw the appearance of the autoradiogram of the Southern blot after hybridization with a cDNA probe. IIn the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
- Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
- When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were obtained: Tetranucleotide Hexanucleotide Nonanucleotide Decanucleotide Dodenucleotide Octadecanucleotide Nonadecanucleotide 21-nucleotide 6c. What is the sequence of the bases in the mRNA coding for the peptide above? TheWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.
- Arrange the following list of eukaryotic gene elements in the order in which they would appear in thegenome and in the direction traveled by RNA polymerase along the gene. Assume the gene’s singleintron interrupts the open reading frame. Note thatsome of these names are abbreviated and thus do notdistinguish between elements in DNA versus RNA.For example, splice-donor site is an abbreviation forDNA sequences transcribed into the splice-donor sitebecause splicing takes place on the gene’s RNA transcript, not on the gene itself. Geneticists often usethis kind of shorthand for simplicity, even thoughit is imprecise. (a) splice-donor site; (b) 3′ UTR;(c) promoter; (d) stop codon; (e) nucleotide towhich methylated cap is added; (f) initiation codon;(g) transcription terminator; (h) splice-acceptorsite; (i) 5′ UTR; (j) poly-A addition site; (k) splicebranch site.In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site that is farther upstream from the normal site. The normal and mutated sequences show the sense DNA strands of a normal and thalassemic patient. 5' CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3' 5' CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3' 3' end of mutated intron New start of reading frame Normal 3' end of intron What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient that results from the aberrant splicing? Use the codon table and write the peptide sequence using three-letter amino acid abbreviations separated by hyphens. amino acid sequence: Pro-The-Ser-Leu-Phe-Ser-Thr-Leu-Arg-Leu-Leu Incorrectin the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.