A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA 2.Scientist wanted to determine what molecule held the ‘gene ‘ if they did a study in which a cell was infected by a virus,which part of the virus actually caused the infection inside the cell!? -Dna -ribosome -protien -Rna

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Prokaryotic cells can have more than one functional start codon per mRNA because  There are…

A: It is a multiple choice question

Q: Draw a labelled diagram depicting the flow of genetic information from DNA to mRNA of a eukaryotic…

A: A fundamental principle that describes how genetic information moves throughout a biological system…

Q: Zinc finger nuclease is a Gene editing tool:     which uses a site-specific endonucleases…

A: (Since the student have not mention the specific question to answer, only one and first question…

Q: Which of the following statements about RNA polymerase II is correct? It can produce several…

A: RNA polymerase is an enzyme in molecular biology that synthesizes RNA from a DNA template . During…

Q: -35 consensus sequence: -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the…

A: At 10 sequences and 35 nucleotide sequences upstream from the coding sequence and Shine Dalgarno…

Q: You perform a translation experiment with mRNA and all required molecules in two identical test…

A: It is the process in which a RNA is coded to form a protein.  The mRNA formed from the corresponding…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: DNA (deoxyribonucleic acid) is a molecule that carries genetic information in living organisms. It…

Q: How does the nucleotide sequence of the (+) DNA strand differ from that of the RNA transcript?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Which of the following statements is CORRECT for a protein with an N-terminal ER signal sequence? O…

A: Proteins synthesized by membrane bound ribosomes translocate the ER membrane co translationally. %…

Q: 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right…

A: Three parts are solved in case of interlinked question as per our company policy. If you want…

Q: The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA…

A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…

Q: Could you please answer the part of the question where they ask you to motivate your answers?

A: A transcription bubble is a chemical structure that forms when a little piece of the DNA…

Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…

A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…

Q: The Shine Dalgarno sequence is ____________. located in the 50S subunit of ribosome. located on…

A: The correct option is (C) a sequence upstream of the AUG initiation codon on mRNA.

Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…

A:

Q: The following image depicts a short stretch of sequence associated with a gene. Which of the…

A: The given DNA strand is as follow 5'- AACTATAAGCCTTGGCCGATTCGATGCTAAATTGCGCATAA-3 We know DNA has…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.