a mistake in the genetic code at the start of a gene which changes EVERY AMINO ACID AF a change to a hydrophilic amino acid a silent mutation a change from an amino acid to a glucose molecule a change to a hydrophobic amino acid a deletion or insertion

a mistake in the genetic code at the start of a gene which changes EVERY AMINO ACID AF a change to a hydrophilic amino acid a silent mutation a change from an amino acid to a glucose molecule a change to a hydrophobic amino acid a deletion or insertion

Name: a mistake in the genetic code at the start of a gene which changes EV
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: a mistake in the genetic code at the start of a gene which changes EVERY AMINO ACID AFTERWARDS is likely:a change to a hydrophilic amino acida silent mutationa change from an amino acid to a glucose moleculea change to a hydrophobic amino acida dele

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Similar questions

Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…
Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.
A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine base
Which of the following statements is true regarding the genetic code? O One DNA base contributes to two codons O Prokaryotes use a simple one-base code, while eukaryotes use a three-base code O Codons are translated as overlapping triplets O Most amino acids are coded for by more than one codon
A small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine base
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'
The genetic message to make a specific amino acid in a protein, is carried by a specific three nucleotide unit on the messenger RNA called a
The end result of BOTH transcription and translation of the DNA sequence AAGCTGGGA would result in? Oan MRNA strand with the sequence TTCGACCCT Oan MRNA strand with the sequence UUCGACCCU a sequence of three amino acids linked by peptide bonds Oa carbohydrate in the form of a polysaccharide
Which of the following is a feature of tRNA that is important for its function in translation? O The codon that pairs with the mRNA Covalent, intramolecular bonds that confer secondary structure O The aminoacyl bond to an amino acid O Its ability to serve as an enzyme that catalyzes peptide bond formation
Which enzyme is responsible for "charging" tRNAS with the correct amino acid? OAminoacyl-tRNA synthetase ATP synthase Ribosomes RNA polymerases O O O
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'
True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines Both pentose nucleic acid and deoxypentose nucleic acid and deoxypentose nucleic acid Contain the same purines RNA contains cytosine and thymine DNA and RNA are hydrolysed by weak alkali The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA A given tRNA can be charged with only one particular amino acid