A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: — AATTGCCCGATCGATTAAGCCA — Sequence with treatment: — AATTGTTTGATCGATTAAGCTA —

Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC…

A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…

Q: Devonte asked his colleague George to verify his results by repeating the sequencing experiment in a…

A: Sanger dideoxy sequencing method is also known in the genetics as chain-termination sequencing this…

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the…

A: DNA stands for deoxyribonucleic acid and it consists of 4 types of nitrogen bases, adenine, guanine,…

Q: The following data shows bisulfite sequencing results for a small region of the genome. How many…

A: The process by which the methyl groups are added to the DNA is called the DNA methylation.…

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: You are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in…

A: DNA sequencing is an important technique used to determine the sequence of unknown fragments of DNA…

Q: A linear piece of DNA that is 14 kb long is cut first by EcoRI alone, then by SmaI alone, and…

A: Restriction enzymes are the endonucleases that digest the DNA at specific sites called restriction…

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…

Q: 4b) Chargaff was the first person to isolate large strands of genomic DNA, rather than small…

A: DNA is the hereditary material in humans and almost all other organisms. Nearly every cell in a…

Q: In producing genetically engineered human insulin in bacteria, why is it important to use the…

A: Insulin is a natural peptide hormone produced by the beta cells of the pancreas in response to high…

Q: 1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with…

A: Restriction map is a map of the restriction sites present in gene/DNA sequence. Restriction enzymes…

Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6-bp sequence. However, the…

A: To answer this question we should have knowledge of Biotechnology

Q: Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus…

A: Restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence…

Q: Name the enzymes that cut the DNA at specific sequences and create sticky ends.

A: A substance produced by a living organism that acts as a catalyst to bring about a specific…