A double stranded DNA fragment contains 22% cytosine residues. What is the percentage of thymine residues? 44% 28% O 22% 56%
Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: How many different sequence possibilities are there for a double-stranded RNA polymer that is 6…
A: At each base, one can have any of the four different bases (A,U,C or G). Therefore for the first…
Q: Describe the basic features of the DNA double helix
A: BASIC INFORMATION CELL It is considered as the basic unit of life Every organism is made up of cell…
Q: If the DNA has a triplet code of CAG in one strand. What is the complementary triplet code in the…
A: Please post MCQ's as separate questions.
Q: DNA molecules of different sizes are often separated with the use of a technique called…
A: Electrophoresis is a technique that is used to separate molecules based on their sizes.
Q: A circular double-stranded DNA molecule contains 4200 base pairs. In solution, the molecule is in a…
A: A higher-order DNA structure is defined by DNA supercoiling. DNA's double-helical structure involves…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: Which of the following equations are true for double-stranded DNA? a) (%G+%T) =(%A+%C) b) (%G+%A)…
A: DNA stands for deoxyribonucleic acid. It is a genetic material that passes from one generation to…
Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…
A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…
Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…
Q: A double stranded DNA has Phosphate groups are on the outer surface of the double helix while the…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: Which of the following are possible base compositions for double stranded DNA? O A=30% G=20% C=20%…
A: DNA is composed of nucleotides which are composed of nitrogenous bases, a pentose sugar, and…
Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…
A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…
Q: Which of the following relations will be true for the percentage of bases in double-stranded DNA? a.…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…
A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors, The…
Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…
A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…
Q: If a double-stranded DNA molecule is 15% thymine, what are the percentages of all the other bases?
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic…
A: In DNA, there are four nitrogenous bases namely, Adenine (A), Guanine (G), Thymine (T) and Cytosine…
Q: Describe in detail the semi Conservative replication of the DNA double helix structure
A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: In a Ramachandran plot, right-handed alpha helixes are usually in which quadrant? Top left Top right…
A: Ramachandran plot is known to determine the distribution of dihedral angle backbone of the peptide…
Q: Of adding lable sait Table salt dissociates into Na* and Cl" in water. The Na* binds to positively…
A: DNA extraction is the chemical method that is used to isolate or extract DNA from the nucleus and…
Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…
A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (NH2) with keto…
A: Nitrous acid, a potent chemical mutagen, exerts its effect by the deamination of the amino groups of…
Q: Which of the following have nitrogenous bases correctly paired in DNA? Select one: O a.…
A: DNA or deoxyribonucleic acid is the genetic material of most living organisms except for certain…
Q: The genetic code is based on four different bases with the structures shown here. Determine the…
A: Nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a base. The…
Q: A DNA sample contains 21% adenine. What is its completepercentage base composition?
A: DNA is the deoxyribonucleic acid which is a double-stranded helical structure found in the nucleus…
Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…
A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…
Q: For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA…
A: "Since you have asked multiple questions, we are eligible to answer only the first three parts.…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…
Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…
A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…
Q: Question mentioned in the attachment
A: B form of DNA is considered a right-handed double helix DNA. It tends to runs in opposite directions…
Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…
A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…
Q: 1. Phosphate 2. Ribose sugar 3. Deoxyribose sugar 4. Uracil 5. Thymine 6. Adenine 7. Guanine 8.…
A: Adenine is the nucelotide which join to the deoxyribose sugar and binds to the thymine nucleotide
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Draw the following structures and rate their relative solubilities in water (most soluble to least…
A: DNA is one of the types of nucleic acid. This structure is made up of small units called…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…
Q: If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the…
A: In order to make the complementary strand we have to look on following things:- DNA → DNA adenine →…
Q: If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the…
A: The DNA is transcribed into the RNA by the process of transcription and translation is the process…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: If the length of E.coli DNA is 1.36 mm, calculate the number of base pairs it contains
A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic information for an…
Q: #1: 3’ T A C A T G C C G A A T G C C 5’ #2: 3' T A C T…
A: The mRNA is produced from the DNA by the process of transcription and proteins are produced from the…
Q: Which of the following relations or ratios would be true for a doublestranded DNA molecule? a. A +…
A: Deoxyribonucleic acid or DNA is a double-stranded molecule present in the nucleus of the cells in…
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: Polynucleotides The word polynucleotides can be split into two words "poly" which means "many" and…
Q: If a region of one strand of a DNA double helix has the sequence 5'-CAGATAC-3', what is the sequence…
A: The nucleotide base pairing is complementary that is two complementary nitrogenous molecules are…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
Q: What is the best description of how the two strands are aligned with each other in the double helix…
A: Introduction :- Humans and nearly all other species carry their genetic information in DNA, also…
Learn your way
Includes step-by-step video
Step by step
Solved in 3 steps
- A double stranded DNA fragment contains 12% adenine residues. What is the percentage of cytosine residues? O 76% O 12% О 38% O 24% O o ooif the guanine content of certain segment of double-stranded DNA is 22% what is the adenine content?If a DNA double helix contains 28% T nucleotides, then what is the percentage of A nucleotides?
- Describe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-HelixThe template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]
- One DNA chain of a DNA double helix contains 18% A, 35% T, 28% C, and 21% G. What is the composition of the complementary DNA chain?Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are in the segment? How many uracil residues are in the segment?
- A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the nucleotide sequence in the complementary DNA strand and then (b) the sequence transcribed from the template strand in mRNA DNA information strand: 5’ AAC GTT CAA ACT GTC 3’In a single strand of DNA, is it ever possible for the number of adenines to be greater than the number of thymines? DescribeAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________