f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic code provided by the functional groups located on each base as H-HD-CH3-HA-HA-HA-HA-HD, then what is the corresponding sequence of bases? (H = hydrogen, HD = hydrogen donor, HA = hydrogen acceptor, CH3 = methyl)

f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic code provided by the functional groups located on each base as H-HD-CH3-HA-HA-HA-HA-HD, then what is the corresponding sequence of bases? (H = hydrogen, HD = hydrogen donor, HA = hydrogen acceptor, CH3 = methyl)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 7QP: List the pyrimidine bases, the purine bases, and the base-pairing rules for DNA.

See similar textbooks

Similar questions

List the pyrimidine bases, the purine bases, and the base-pairing rules for DNA.
A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are in the segment? How many uracil residues are in the segment?
What is the sequence of amino acids coded by the following sequence of nucleotides on a strand of DNA from the 5' to 3' end? A - T - C - G - C - T - A - C - G - A - A - T How many nucleotides are there?
DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?
Describe the functions of the following proteins during DNA breaks and repair: (i) Ku70 (ii) Uracil DNA glycosylase
Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
TRUE OR FALSE a) The 2 chains composing one double helix run in opposite directions; they are antiparallel (one is 5’->3’ and the other 3’->5’). b) DNA molecules can perform their function in replication and transcription as long as the hydrogen bonds between the bases remain intact.
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:
Write the complementary sequence for the following DNA sequence, in order from 3' to 5': 5′−CGATATTGAGCTAAGCTT−3′
Two highly negatively charged complementary strands of DNA come together to form a double helix. What prevents them from repelling each other?