A cytogeneticist has collected tissue samples from members of acertain butterfly species. Some of the butterflies were located inCanada, and others were found in Mexico. Through karyotyping,the cytogeneticist discovered that chromosome 5 of the Canadianbutterflies had a large inversion compared with chromosome 5 ofthe Mexican butterflies. The Canadian butterflies were inversionhomozygotes, whereas the Mexican butterflies had two normalcopies of chromosome 5.Explain whether a mating between Canadian and Mexicanbutterflies would produce phenotypically normal offspring?

Q: Mitotic recombination can occasionally produce a twin spot.Let’s suppose an animal species is…

A: It is given to suppose that if an animal species is heterozygous for the 2 gene governing fur colour…

Q: In humans, chromosome 16 sometimes has a heavily stained area in the long arm near the centromere.…

A: Nondisjunction means failure of pair of homologus chromosome to separate or segregate either during…

Q: In humans, chromosome 16 sometimes has a heavily stained area near the centromere. This feature can…

A: So, non disjunction of the chromosomes occurs in the condition when the homologous chromosomes fail…

Q: An inversion heterozygote has the following inverted chromosome: Centromere A B CD JI HGF E KL M…

A: Introduction :  Inversions are rearrangements in chromosome genetic sequences wherein small regions…

Q: Outline the molecular steps in the process of X-chromosomeinactivation (XCI). Which step plays a key…

A: Euchromatin is defined as the active form of chromosomal DNA whereas heterochromatin is defined as…

Q: About 5% of individuals with Down syndrome havea chromosomal translocation in which a third copy…

A: Humans have 23 pairs of chromosomes, that is, the normal chromosome number is 46. Translocation can…

Q: When Thomas Hunt Morgan crossed his red-eyed F1 generation flies to each other, the F2 generation…

A: The result observed by Thomas Hunt Morgan, where all the white-eyed flies in the F2 generation were…

Q: A heterozygous reciprocal translocation involving 2 non-homologous chromosomes resulted to a new…

A: Translocation refers to a change in location. In genetics, some part of a chromosome is transferred…

Q: What is the observation of the overhanging length of chromosome arms during anaphase compared to the…

A:

Q: Referring to Figure 17-19, draw a diagram showing the process whereby an inversion formed from…

A: An inversion is a type of chromosomal rearrangement in which a chromosomal segment is reversed end…

Q: What unusual feature of the Y chromosome allows some recombination among the genes found on it?

A: Every individual has 23 pairs of chromosomes, out of which 22 are identical, one ie sex chromosome…

Q: Person A has a mutation in a chromosome in a liver cell, while person B has a mutation in a…

A: Mutation refers to sudden heritable change in the phenotype of an individual. In the molecular term,…

Q: Consider the example of the fusion of chromosome 21 and 14. By itself, this fusion does not cause…

A: In humans, when the long arm of chromosome 21 is joined to the long arm of chromosomes 14 or 15, the…

Q: Why does therecombination frequency ofgenes vary with the distancebetween them in thechromosome?

A: The genetic material exchange between the two homologous chromosomes and that produces recombinant…

Q: A gene involved with body colour in this species of fruit fly is located on the non-homologous…

A: The Gene for Eye Color in Drosophila: Red vs. BrownIntroductionThis species of fruit fly possesses a…

Q: The birth of this child prompted the Dentons' physician to order a chromosome study of parents and…

A: In order to fully understand the question being asked, we must recall the following information: (1)…

Q: What are the chromosome configuration that will be observed at diakinesis in the following…

A: Chromosome are thread-like structures present inside the nucleus of a cell. Chromosomes are made up…

Q: Researchers have discovered that some regions of chromosomesare much more likely than others to…

A: No, the distance between A and B and C and D are not same. As A and B genes are in hot spot means…

Q: On rare occasions, an organism may have three copies of achromosome and therefore has three copies…

A: Nondisjunction is the failure of homologous chromosomes or sister chromatids to separate properly…

Q: For each of the terms in the left column, choose thebest matching phrase in the right column.a.…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Which of the following is false regarding Down Syndrome? O can be caused by a Robertsonian…

A: The thread like structures seen inside the nucleus of every cells are called chromosomes. These are…

Q: A rare form of dwarfism that also includes hearing loss was found to run in a particular family. It…

A: The inheritance patterns explain how a disease is transmitted in families. These patterns help to…

Q: A female fruit fly has one normal X chromosome and one X chromosomewith a deletion. The deletion…

A: Deletion: Chromosome segment comprises 1 or more genes separates and is lost. It is further of two…

Q: DRAW IT Suppose, as in the questionat the bottom of Figure 15.9, the parental(P generation) flies…

A: Consider the following V= Normal wing v= Vestigial wing G= Gray body-color g= Black body-color Then,…

Q: A chromosome with the following gene order has a paracentric inversion of BCDE. A B C D E F • G H If…

A:

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: Drosophila geneticists made the first genetic maps. They claimed that the gene loci that they mapped…

A: Genetic map is the one that gives the probable location of genes on a chromosome. A genetic map is…

Q: why The chromatids formedby recombination within the inversion loop of a paracentric…

A: When the region between two breaks of the same chromosome rotates 180°, it results in chromosomal…

Q: In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field,…

A: Introduction Gel electrophoresis is a technique that uses size and charge to separate and analyse…

Q: A male Drosophila from a wild-type stock is discovered to have only seven chromosomes, whereas…

A: As mentioned the chromosome IV is attached to the distal end (which is farther from the centromere…

Q: Mutation

A: A) Genetic in drosophila have provided a wealth of information about a variety of cellular and…

Q: why The chromatids formedby recombination within the inversion loop of a paracentric…

A: When the region between two breaks of the same chromosome rotate 180°, it results in chromosomal…

Q: If you assume Figure 2-15 also applies to mice and youirradiate male sperm with X rays (known to…

A: The similar regions in two chromosomes  are considered to be homologous. Hence the X and Y…

Q: While most animals cannot tolerate polyploidy, somemollusks, such as oysters, can. Although wild…

A: Some mollusks such as oysters tolerate polyploidy. Farmed oysters are triploid while the wild…

Q: A male Drosophila from a wild-type stock is discovered to haveonly seven chromosomes, whereas…

A: In male drosophila, one member of chromosome IV has translocated to the distal end of Chromosome II.…

Q: A cytogeneticist has collected tissue samples from members of a certain butterfly species. Some of…

A: There are two sets of butterflies in the given question: the Canadian and Mexican groups. By using…

Q: In a genetic laboratory, a plant species was subjected to radiation to produce chromosome mutations.…

A: Mutations are changes in the DNA sequence of a chromosome which may or may not affect the phenotype.

Q: Rainbow trout go through a unique genetic reproductive process. Female eggs are diploid, while male…

A: Chromosomes are thread-like structures present inside the nucleus of the cell. Usually, they are…

Q: The STR DNA marker DS11 is located on the p arm of the chromosome #8 in humans. Molecular analysis…

A: A pattern of two or more nucleotides repeated next to each other is known as a short tandem repeat…

Q: Rainbow trout go through a unique genetic reproductive process. Female eggs are diploid, while male…

A: (Comment : As per the guidelines, we are allowed to answer one question at a time, so I am answering…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.