A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops around the world by causing a wheat disease that has the same symptoms as a well-known bacterial plant pathogen. In an attempt to mitigate the damage, you are selected to investigate the origins of this fungal disease. Design a plan to address this issue that includes: • A well justified hypothesis for the origin of the disease • An experiment to test your hypothesis • A cartoon of how the data would look like if your hypothesis is validated (yes, draw a graph/diagram of the data that would support your hypothesis)
Q: In peas, the yellow allele is dominant over the green allele. A plant with yellow peas was crossed…
A: In this cross, the dominant allele for yellow peas is represented as G, and the recessive allele for…
Q: Which line represents the activation energy of the non-catalyzed reaction? Free energy L a. b. C. d.…
A: Answer : the graph which represents activation energy of non catalyst is : C) cexplaination : non…
Q: abel the diagram by dragging the labels to the appropriate targets. DNA's secondary hydrophobic…
A: DNA or deoxyribonucleic acid contains the hereditary units called "genes" that carry information…
Q: Maximum Activity No Activity Pepsin Sucrase Trypsin 11 12 PH This graph shows the activity level for…
A: The frequency of enzyme-substrate interactions or the ability of the enzyme and substrate to…
Q: Question 8 Myoglobin and the subunits of hemoglobin have: O very similar primary and tertiary…
A: Hemoglobin is an iron-containing protein, present on the surface of RBCs and carries oxygen from…
Q: What do the preceding tests tell you about the case?
A: Based on the above inquiries and responses, the accompanying data has been obtained:The blood sample…
Q: In the pedigree below what is the expected mode of inheritance?
A: Pedigree analysis helps us to understand the mode of inheritance of a particular trait (disease) by…
Q: When writing a scientific report there is no need to report and if percentages are being reported.…
A: A scientific report is a written summary of a scientific research's methodology, developments,…
Q: If the clamp loader on DNA Pol III were not efficient at loading the new clamp, which strand of the…
A: DNA Polymerase III is a complex protein involved in DNA replication. It has several subunits,…
Q: Explain how spider monkeys traits benefit them.
A: Spider monkeys are arboreal primates known for their prehensile tails, which help them swing through…
Q: code for Radiopharmaceutical therapy by intravenous administration
A: When the drugs are administrated into the body system of an individual by directly releasing them…
Q: 4.explain in deatails positive and negative the role of the american cocorach plays with humans 5)…
A: American cockroach is the largest species of domestic Cockroaches. They are not a confined to…
Q: D G A C E B F H
A: In phylogeny, clades represent groups of organisms that share a common evolutionary ancestor. They…
Q: Which of the following statements about the evolution of life on Earth, from simple prokaryote-like…
A: The evolution of life on Earth is a remarkable process that has led to the development of complex…
Q: Match each biological molecule with the proper set of functions. Short term energy, cell…
A: Biomolecules are biological molecules produced by the cells of a living being. They are the most…
Q: Rank these amino acids from most to least hydrophobic. COO™ COO™ çoo
A: Think of amino acids as characters in a story. Leucine is the 'shy' one who avoids water, so it's…
Q: Which of these is/are true of the autonomic nervous system? Check all that apply. Check All That…
A: The brain, spinal cord, and a sophisticated nerve network are all parts of the nervous system. The…
Q: Which of the following concept maps correctly describe the relationship among these four terms -…
A: Genomic is field of study which is used in order to comprehend the structure as well as the function…
Q: Question 5 (1 point) Listen Saved Channel proteins transport large macromolecules lipids and…
A: The main purpose of a channel protein is to transport the ions and water molecules quickly through…
Q: What is the relationship between an increase in fossil fuel consumption and increased carbon in…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Part A Sort the examples into the appropriate bins. development of pesticide resemblance of island…
A: Fossil records are preserved remains or traces of ancient organisms found in rocks and sediment…
Q: Which of the following method is employed in the sample preparation for the cryo-electron…
A: Cryo-electron microscopy (Cryo-EM) is an advanced imaging technique used to visualize the structures…
Q: Cross Section of Earthworm
A: Earthworm is a terrestrial invertebrate organism that is found in soil. The phylum of earthworm is…
Q: Which of the following are the correct products of 1 turn of the Krebs cycle per glucose molecule?…
A: Before the Krebs cycle begins, oxidation of pyruvate obtained as a result of glycolysis takes place,…
Q: Read the study in the picture and answer the following questions. 1. List the specific strengths and…
A: Specific Strengths of the Study:Case-Control Design: The study used a case-control approach, which…
Q: You, a hospital administrator, are confronted by a news reporter who asks about an outbreak in your…
A: Here portrayed a critical epidemic of Clostridium botulinum, an anaerobic spore-forming microbes, in…
Q: 2-4 sentences, compare the responses of voltage-gated Na+ and K + channels to polarization in…
A: While Comparing the responses of voltage-gated Na+ and K+ channels to the depolarization. Both the…
Q: What are functions of the M7G cap? Select all the apply. Slows degradation from the 5' end of the…
A: The process by which mRNA is produced from DNA is called transcription and the process by which…
Q: You are planning a trip to Kansas, in the United States this summer. Which of the following pictures…
A: Climate and precipitation patterns regulate biome distribution across the world. Different regions…
Q: This is a picture of a plant that grows in the tundra with the common name arctic willow. Plants…
A: The tundra is an ecosystem characterized by extremely cold temperatures, low precipitation, and a…
Q: In horses, the Overo gene, Ov, produces a white splotch pattern on the coat. The overo phenotype is…
A: The Overo gene (Ov) in horses produces a white splotch pattern on the coat when present in a single…
Q: A group of individuals that can interbreed in nature and produce viable offspring would be…
A: A species is a group of living beings that can interbreed or share certain characteristics. A…
Q: Telomeres are at the end of linear chromosomes, and have a characteristic repeat sequence (5…
A: Telomeres are the repetitive nucleotide sequences present at the bottom of the chromosomes.These…
Q: You are a microbiologist, you were using spread plate counts to quantify the effects of a new…
A: The spread plate count is a microbiological technique used to determine the concentration of…
Q: match the following mitosis terms with the following descriptions
A: Cell division is a tightly regulated multi-step process by which the cell splits into two daughter…
Q: 18. During cytokinesis, plant cells form a a. Cell furrow b. cleavage furrow c. cell plate d.…
A: Cytokinesis is the final stage of cell division in which the cytoplasm splits between the two newly…
Q: 2. Robert Koch was a German physician who identified the bacteria causing anthrax and tuberculosis.…
A: "Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: A female fruit fly with vermilion eyes and normal wings is crossed with a male with normal red eyes…
A: This question involves the principles of genetics and inheritance, specifically focusing on the…
Q: Which of the following technique is FALSE in microscopy? Osmium tetroxide can be used as a fixative…
A: Microscopy is a scientific method employed to observe and analyze objects and structures that are…
Q: Identify the structure labeled "2" tendon muscle cell (fiber) sarcomere 3 myosin fascicle 2
A: The muscles with alternate light and dark bands which remain associated with skeleton and can…
Q: cientists have seen the rate of growth of phytoplankton biomass across the Arctic Ocean increase by…
A: Phytoplanktons are the autotrophic components of freshwater or ocean ecosystemsIn the Arctic Ocean,…
Q: ATP energy for generates produce some produces many cellular work (a) (b) chemiosmosis has three…
A: Every living organism performs cellular respiration that is responsible for the breakdown of…
Q: You are trying to track a motor protein dynein movement on a microtubule in a cell using GFP-tagged…
A: Microtubules serve as the arena for dynein motor proteins, and these proteins exhibit rapid…
Q: PLANT VOCABULARY DOMINANT GENERATION Sporophyte/Gametophyte CELL TYPE IN ADULT ORGANISM Haploid =…
A: Coniferophyta is otherwise known as conifers. They are known for their needle-like or scale-like…
Q: Suppose a mutant RNA polymerase Il is used that lacks one of the phosphorylation sites on the…
A: The production of RNA from the DNA template is known as transcription or gene expression. The main…
Q: A small tumor is excised from a patient's body by a biopsy. A clinical cytopathologist wants to…
A: The optimal microscopic method for examining cell shape, size, and arrangement within a tumor during…
Q: PROBLEM 3 4. Show the Punnett square for the cross of a homozygous red eyed female and a white eyed…
A: Drosophila flies exhibit the XX and XY type of sex-determination. In this type of sex determination,…
Q: What neurotransmitter(s) does cannabis affect? What kinds of effects does it have on these…
A: The nervous system's nerve cells, or neurons, communicate with one another chemically via…
Q: See image
A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: Key Term Matching 1. Interphase 2. Nucleus 3. S phase 4. Centromere 5. Metaphase 6. Ribosome 7.…
A: There are two types of cell divisionsMitosis - It is an equational division meaning during mitosis…
Step by step
Solved in 4 steps
- One of the following statements is not true? O a. The exoantigens technique reduces for exposure to biohazardous fungi O b. The presences or absence of specific AB's may not have diagnostic value in situation of a preexisting humoral response rather than pathological lesions related to active diseases. O c. The exoantigens is not useful for determining's fungi taxonomic relatedness d. it is difficult to make an exact fungal diagnosis by immunological reaction because of common antigens in two different fungi speciesYou have been asked to consult for a biotech company that is seeking to understand why some fungi can live in very extreme environments, such as the high temperatures inside naturally occurring hot springs. The company has isolated two different fungal species, F. cattoriae and W. gravinius, both of which can grow at temperatures exceeding 95°C. The company has determined the following things about these fungal species (see attached image) By sequencing and examining their genomes, the biotech company hopes to understand why these species can live in extreme environments. However, the company only has the resources to sequence one genome, and would like your input as to which species should be sequenced and whether you believe a shotgun strategy will work in this case.Research an interesting example of mutualism, and present your findings in a post. The goal here is to provide examples beyond what is presented in lecture and/or your textbook. These can be animal-animal, animal-fungal, plant-fungal, plant-animal, bacteria-animal....the sky is the limit! For this particular forum, you'll be able to see other classmates postings even before you post your own. This is so you can present an example that's different from what's already been discussed. Remember that mutualistic interactions are associations that benefit both parties -- so your response should clearly indicate the role each partner plays. Let us know where these organisms are found, what kind of habitat they live in, and any other interesting , pertinent information. Also, please comment on how natural selection likely played a role in the development of your example. You can use your imagination a bit here -- I'd just like to see you connect the ideas. Your posting must be at least…
- Explain briefly the theory that suggests that: Life originated from the spores.(Please, the answer should be related to NCERT Biology if possible)Many antibiotics are produced by fungi. What is the evolutionary advantage of producing compounds to inhibit the growth of bacteria? Select one: cross out O a. There is no advantage; it is a byproduct of their extracellular digestion cross out O b. Bacteria are a main source of nutrition for fungi cross out O C. To reduce competition in the surrounding soil cross out O d. To attract other organisms to the soil Clear my choicemt In the answer area include the following: a. Name of the organism. b. Phylum. Use the editor to format your answer 99 minutes remaining phtlum - phy lkm Hepatophyta Cliveworts)/Marcnantia Phylum 12ggomycota/Ahizapu fo ophylumiAscomycota (Sac fungi)/ev Penicilum, Aspergiaus Phyfum: Brgo phgta (Mossey poly trichum SPecTeE (uascalar Seodless Plants) Phylums Ascomyeota (sac fung) Ase ferophyta (Fens). phalum, AScomncota x fna op hyta (whiskfems) Species •Phylan Baidion Ge Club MOsseS) • phylam) &conyceta G ztails).
- Which of the following is a parasitic fungi on the mustardplant ?(a) Albugo (b) Puccinia(c) Yeast (d) Ustilago Please try to break the solutions into as many steps as practically possible and the steps should come one by one and they should be short and crisp and plagiarism-free.Which of the following pair is NOT a match? O Chlamydias - chalamedya trichomatis (causes STD that can lead to blindness) O Epsilon Protobacteria - Helicobacter pylori (human pathogen causing stomach ulcer) O Spirochetes - Treponea pallidum (causes Syphillis) O Alpha Protobacteria – Rhizobium sp. (N2 fixation in legumes) O Gram positive bacteria – Oscillatoria (filamentous phytoplankton)Do you have any suggestions on how they could have controlled the spread of kudzu? As you stated in your post, the plant thrives in certain environmental conditions. Do you feel that certain environmental aspects can be purposely altered in an attempt to slow the progress of the plant? I was more interested in the kudzu plant as it has the ability to cause great harm, even to the extent of wiping out other plants and trees. Please explain the full bold information please. Thank you
- Microtaxonomy (Species and Speciation) Colletotrichum gloeosporioides is a fungus that causes mango anthracnose. It's a devastating disease being avoided by mango farmers. For example, in the island province of Guimaras, Philippines, one cannot bring mango into the island to avoid contamination of the mango plantations. Guimaras produces the sweetest mango in the world. One challenge in the control of mango anthracnose is that C. gloeosporioides is a species complex. What is a complex and how do we provide clear delineation (if we can) among these closely related species?Number of Bacteria X Temperature (°C) At the After 1 After 2 After 3 beginning day days days 6. 8. 12 15 48 187 15 27 126 678 (a) What is the relationship between the temperature and the rate at which the Bacteria X reproduces? (b) When the number of Bacteria X increases, it causes food to turn bad and cannot be eaten. Based on the results above, what can Rose do to preserve food for a longer period of time? Explain your answer.Developing anti fungal drugs ia more difficult than developing antibacterial drugs. Explain why this is the case , given the evolutionary relationships among bacteria,fungi, and humans.