4. Assume a fish inherits a deletion mutation in the pituitary switch that inactivates the switch. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect to see the pituitary switch mutation? Draw an "X" over the mutated switch in the appropriate tissue(s). Jaw Eye Pelvis Activator 1 Pituitary switch Jaw switch Pelvic switch Pitx1 ብብብብብብብ Pituitary Activator 3 Pituitary Jaw Pelvic switch switch switch Pitx1 Activator 2 Pituitary Jaw switch switch Pelvic switch Pitx1 ከብካብ ካብ ካብ ብጊዜ ብ Activator 4 Pituitary switch Jaw switch Pelvic switch Pitx1

4. Assume a fish inherits a deletion mutation in the pituitary switch that inactivates the switch. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect to see the pituitary switch mutation? Draw an "X" over the mutated switch in the appropriate tissue(s). Jaw Eye Pelvis Activator 1 Pituitary switch Jaw switch Pelvic switch Pitx1 ብብብብብብብ Pituitary Activator 3 Pituitary Jaw Pelvic switch switch switch Pitx1 Activator 2 Pituitary Jaw switch switch Pelvic switch Pitx1 ከብካብ ካብ ካብ ብጊዜ ብ Activator 4 Pituitary switch Jaw switch Pelvic switch Pitx1

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 28CTQ: A scientific study demonstrated that rat mothering behavior impacts the stress response in their...

See similar textbooks

Related questions

Q: In membranes, , motion is fast and motion very slow. a. down, up Ob. transverse, lateral C. lateral,…

A: Membrane : It is a selective barrier; it allows some things to pass through but stops others. Such…

Q: OD OC in jo tas angeba pe angsod e si Sumago au jo zagoud jos bras angebau pur angesa e se mogos and…

A: Qualitative tests are performed to detect the presence of any substance through visible changes in…

Q: Question 5. DNA replication and the production of histones occur during what part of the cell…

A: The Cell cycle has two phases named interphase and M phase. In the M phase, the actual cell division…

Q: Global Warming Experiment Iker is concerned about global warming. He believes that much of the…

A: Global warming is the unusually rapid increase in Earth's average surface temperature over the…

Q: "If a DNA molecule has 12% thymine, how much guanine will it have?" 12% 24% 38% 76%

A: Chargaff rule: According to this rule in a DNA molecule, the base pairing is complementary and it…

Q: Question 11 (1 point) Endoplasmic Reticulum 1) Carbohydrates 2) Proteins 3) Nucleic Acids 4) Lipids

A: The endoplasmic reticulum or ER has two types, the rough ER and the smooth ER. The former is…

Q: Identify the image shown in the picture 29

A: Introduction A cell is known to be the structural and functional unit of all living organisims. A…

Q: Question 7. You are studying two strands of DNA. They have exactly the same length, but the first…

A: The melting temperature highly depends on the G+C ratio in a strand. More the ratio of G+C high will…

Q: Question 9. Which of the following is not formed through a dehydration synthesis reaction? A.…

A: Answer - D. Phospholipid

Q: QUESTION 33 In the image below, the greater omentum, is indicated by letter A D B C

A: Answer:- The greater omentum is a large, apron-like fold of peritoneum, which is the thin, serous…

Q: Pollution from human activities has only minor effects on the environment, so the primary concern…

A: Biology is a branch of science. Bio means life and ology means study. Biology is basically the study…

Q: Question 9 Rivers have never caught on fire before. O True False

A: Rivers have never caught on fire before. O True O False

Concept explainers

Emotions

Emotions are biologically based psychological conditions caused by neurophysiological changes which are linked to different factors such as thoughts, emotions, behavioral responses, and pleasure or displeasure. These emotions are not similar to moods. The mood is an affective state. Mood depends upon several factors, such as weather, the environment, physiology, etc. Emotions can be beneficial or detrimental depending on the situation. Emotional reactions are simple. Emotional well-being is strongly affected by our well-being, and such feelings are private.

Question

Part 2 Bio Question 4

4. Assume a fish inherits a deletion mutation in the pituitary switch that inactivates the switch. You isolate DNA
from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect to see the pituitary
switch mutation? Draw an "X" over the mutated switch in the appropriate tissue(s).
Jaw
Eye
Pelvis
Activator 1
Pituitary
switch
Jaw
switch
Pelvic
switch
Pitx1
ብብብብብብብ
Activator 3
Pituitary
switch
Jaw
Pelvic
switch
switch
Pitx1
Pituitary
Activator 2
00406440
Pituitary
switch
Jaw
Pelvic
switch
switch
Pitx1
Activator 4
Pituitary
switch
Jaw
switch
Pelvic
switch
Pitx1

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Explaining mutations

VIEW

Step 2: Explaining the working of pituitary switch

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

10. Protein expression can be blocked by antisense oligonucleotides. Which mechanism enables antisense oligonucleotides to block protein synthesis? O Antisense oligonucleotides bind to ribosomes and inhibit their function. Antisense oligonucleotides bind to DNA in the nucleus and inhibit the synthesis o MRNA. Antisense oligonucleotides bind to ribosomal RNA (rRNA) and inhibit ribosome assembly. Antisense oligonucleotides bind to messenger RNA (MRNA) and prevents mRNA binding to ribosomes.
3. MyoD is a transcriptional activator that turns on the expression of several muscle specific genes in human cells The Id gene represses the function of MyoD. There are 2 possibilities: 1. Id protein directly represses the expression of these muscle specific genes. 2. Id inhibits muscle specific genes indirectly by preventing MyoD's function. If you knew Id's protein sequence, how can you figure out if explanation 1 or 2 is true?
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
6. Vampire bats are mammals that consume blood as their only source of nutrients. Because blood is rich in iron, it is necessary for the digestive system of the vampire bat to manage excess iron. Like humans, ferritin and transferrin receptor gene products are expressed by the vampire bat genome and function to maintain iron homeostasis. Ferritin A. The iron response element (IRE) binding protein is able to regulate expression of both ferritin and transferrin receptor genes. What feature of these genes allows for specific regulation by the IRE binding protein? B. How is activity of the IRE binding protein regulated? C. In an environment with excess iron, what levels of mRNA and protein do you expect to detect of Ferritin and Transferrin receptor? Briefly explain. Explanation Transferrin receptor RNA levels ( ) high ( ) low ( ) high ( ) low Protein levels () high levels ( ) low levels () high levels ( ) low levels
Many human cancers result when a normal gene mutates and leads to uncontrolled growth (a tumor). Genesthat cause cancer when they mutate are called oncogenes. Chemotherapy is effective against many tumorsbecause it targets rapidly dividing cells and kills them.Unfortunately, chemotherapy has many side effects,such as hair loss or nausea, because it also kills many ofour normal cells that are rapidly dividing, such as thosein the hair follicles or stomach lining.Many scientists and large pharmaceutical companiesare excited about the prospects of exploiting theRNAi pathway to selectively inhibit oncogenes in lifethreatening tumors. Explain in very general terms howgene-silencing therapy might work to treat cancer andwhy this type of therapy would have fewer side effectsthan chemotherapy
1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B- globin chain of hemoglobin. The beginning of HBB is shown here: 5'-ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT...-3' A. Translate this HBB sequence into an amino acid sequence. B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobin to aggregate, causing red blood cells to deform into a sickle-like shape rather than the normal “biconcave disk" shape. C. What would happen if the bolded blue A were mutated to at T? (This is hypothetical; it's not a mutation found in sickle-cell disease.)
5. This diagram illustrates regulation of the Pitx-1 gene, which is expressed in various cell types • during certain stages of animal embryonic development. Answer the questions that follow: Promoter Coding Region Pelvis Olfactory Jaw Regulatory Segments ("Switches") a. Which portion of this sequence gets transcribed and translated into a protein? b. Which portion of this sequence underwent a deletion mutation in certain species of freshwater stickleback fish? Did that mutation have an impact on the amino acid sequence of the protein, when it was expressed? С. d. If this switch underwent the same mutation in a turtle embryo, how would the turtle's phenotype be impacted? е. Would this phenotypic change in the turtle likely be adaptive? Briefly explain.
6. Unlike tetrapods or many other reptiles, snakes have no limbs. Analysis of expression of their homeotic genes shows that for three types of homeotic genes, which for convenience we will call HoxY (yellow), HoxB (blue), and HoxR (red) in the figure, the pattern of expression is different in embryos of snakes than it is in reptilian tetrapod embryos, including chick embryos. The arrows in the figure indicate the regions in the embryo from which certain adult structures arise. Anterior Anterior Forelimb Thoracic Thoracic vertabrae vertabrae НоxR Нохв Posterior HoxY Posterior Chick embryo Python embryo Biology: How Life Works, Second Edition O 2016 W.H. Freeman and Company Which of the following would be required to produce a forelimb in snakes? Briefly explain your answer. A. the combination of yellow and blue expressed together B. the combination of yellow and red expressed together C. the combination of blue and red expressed together D. the combination of yellow, blue, and red…
Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO
14. Which of the mutations shown will affect the amino acid sequence of the myosin protein?
1. Using the data available Using the data available on Moodle describe the phenotype that you observe when each of these three genes is knocked down using RNAi. Remember to compare the worms on control RNAi plates with worms on each of the RNAi knockdown plates. In each case state how do these phenotypes relate to the function of the gene. describe the phenotype that you observe when each of these three genes is knocked down using RNAi. Remember to compare the worms on control RNAi plates with worms on each of the RNAi knockdown plates. In each case state how do these phenotypes relate to the function of the gene. 2. Describe further experiments that you could do that would confirm your findings.
2. Consider the scenario where a DNA mutation occurs in a person's skin cells, where the gene p53 becomes damaged, and can no longer be transcribed and translated into a functioning 53kd protein. Why might a mutation of this nature be especially concerning to someone who experiences regular exposure to skin carcinogens, such as UV light? ✓✓✓