4. Assume a fish inherits a deletion mutation in the pituitary switch that inactivates the switch. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect to see the pituitary switch mutation? Draw an "X" over the mutated switch in the appropriate tissue(s). Jaw Eye Pelvis Activator 1 Pituitary switch Jaw switch Pelvic switch Pitx1 ብብብብብብብ Pituitary Activator 3 Pituitary Jaw Pelvic switch switch switch Pitx1 Activator 2 Pituitary Jaw switch switch Pelvic switch Pitx1 ከብካብ ካብ ካብ ብጊዜ ብ Activator 4 Pituitary switch Jaw switch Pelvic switch Pitx1

4. Assume a fish inherits a deletion mutation in the pituitary switch that inactivates the switch. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect to see the pituitary switch mutation? Draw an "X" over the mutated switch in the appropriate tissue(s). Jaw Eye Pelvis Activator 1 Pituitary switch Jaw switch Pelvic switch Pitx1 ብብብብብብብ Pituitary Activator 3 Pituitary Jaw Pelvic switch switch switch Pitx1 Activator 2 Pituitary Jaw switch switch Pelvic switch Pitx1 ከብካብ ካብ ካብ ብጊዜ ብ Activator 4 Pituitary switch Jaw switch Pelvic switch Pitx1

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 28CTQ: A scientific study demonstrated that rat mothering behavior impacts the stress response in their...

See similar textbooks

Similar questions

2. Researchers have discovered significant changes in the gene of some protein, which is a substrate for the insulin receptor. What impact on the insulin signal transduction would such changes have? For the answer: a) draw the scheme of insulin signal transduction in the target cell; b) name proteins and enzymes, activated by insulin in the target cells; c) explain the functions of these enzymes.
1. Insulin is a protein that allows sugar (glucose) to enter the body's cells (mainly liver, adipose tissue and skeletal muscle). This hormone plays a key role in the regulation of glucose levels in the blood ('hypoglycemic' effect). It is produced by the beta cells in the pancreas.A piece of the gene sequence that encodes for insulin contains: 5’ ATG-GCC-CTG-TGG-ATG-CGC-CTC-CTG-CCC-CTG-CTG-GCG-CTG-CTG-GCC-CTC-TGG-GGA-CCT-GAC- CCA-GCC-GCA-GCC-TTT-GTG-AAC-CAA-CAC-CTG-TGC-GGC-TCA-CAC-CTG-GTG-GAA-GCT-CTC-TAC-CTA-GTG-TGC-GGG-GAA-CGA-GGC-TTC-TTC-TAC-ACA-CCC-AAG-ACC-CGC-CGG-GAG-GCA-GAG-GAC-CTG-CAG-GTG-GGG-CAG-GTG-GAG-CTG-GGC-GGG-GGC-CCT-GGT-GCA-GGC-AGC-CTG-CAG-CCC-TTG-GCC-CTG-GAG-GGG-TCC-CTG-CAG-AAG-CGT-GGC-ATT-GTG-GAA-CAA-TGC-TGT-ACC-AGC-ATC-TGC-TCC-CTC-TAC-CAG-CTG-GAG-AAC-TAC-TGC-AAC-TAG 3’ d. Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia which may contribute to diabetes. Identify the amino acid replacement from these mutations. e.…
1. Insulin is a protein that allows sugar (glucose) to enter the body's cells (mainly liver, adipose tissue and skeletal muscle). This hormone plays a key role in the regulation of glucose levels in the blood ('hypoglycemic' effect). It is produced by the beta cells in the pancreas.A piece of the gene sequence that encodes for insulin contains: 5’ ATG-GCC-CTG-TGG-ATG-CGC-CTC-CTG-CCC-CTG-CTG-GCG-CTG-CTG-GCC-CTC-TGG-GGA-CCT-GAC- CCA-GCC-GCA-GCC-TTT-GTG-AAC-CAA-CAC-CTG-TGC-GGC-TCA-CAC-CTG-GTG-GAA-GCT-CTC-TAC-CTA-GTG-TGC-GGG-GAA-CGA-GGC-TTC-TTC-TAC-ACA-CCC-AAG-ACC-CGC-CGG-GAG-GCA-GAG-GAC-CTG-CAG-GTG-GGG-CAG-GTG-GAG-CTG-GGC-GGG-GGC-CCT-GGT-GCA-GGC-AGC-CTG-CAG-CCC-TTG-GCC-CTG-GAG-GGG-TCC-CTG-CAG-AAG-CGT-GGC-ATT-GTG-GAA-CAA-TGC-TGT-ACC-AGC-ATC-TGC-TCC-CTC-TAC-CAG-CTG-GAG-AAC-TAC-TGC-AAC-TAG 3’ a. Mutation of codon 34 (CAC to GAC) and 89 (CGT to CAT) of the insulin gene causes hyperinsulinemia which may contribute to diabetes. Identify the amino acid replacement from these mutations. 2.…
Mutations in the BRCA genes have been shown to be related to a higher incidence of breast cancer in humans, and genetic tests are available that enable women to discover whether they carry versions of the gene associated with high risk. However, even early detection of breast cancer does not guarantee a cure. What considerations can you think of for and against advising women to take the tests? ·
10. Protein expression can be blocked by antisense oligonucleotides. Which mechanism enables antisense oligonucleotides to block protein synthesis? O Antisense oligonucleotides bind to ribosomes and inhibit their function. Antisense oligonucleotides bind to DNA in the nucleus and inhibit the synthesis o MRNA. Antisense oligonucleotides bind to ribosomal RNA (rRNA) and inhibit ribosome assembly. Antisense oligonucleotides bind to messenger RNA (MRNA) and prevents mRNA binding to ribosomes.
I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
3. MyoD is a transcriptional activator that turns on the expression of several muscle specific genes in human cells The Id gene represses the function of MyoD. There are 2 possibilities: 1. Id protein directly represses the expression of these muscle specific genes. 2. Id inhibits muscle specific genes indirectly by preventing MyoD's function. If you knew Id's protein sequence, how can you figure out if explanation 1 or 2 is true?
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
In which tissue(s) is the mRNA and protein highly expressed in? 1. Go to: https://www.proteinatlas.org/2. Type the name of your protein in the search bar. Click "Search"3. Click on the gene name of your protein4. Click on the "Tissue" icon5. Scroll down to the graphs showing Protein and mRNA expression.6. Search for the tissue type that shows high expression in both the protein and mRNA graphs. Kidney Placenta Adipose tissue Stomach Ovary *Can be more than one answer*
6. Vampire bats are mammals that consume blood as their only source of nutrients. Because blood is rich in iron, it is necessary for the digestive system of the vampire bat to manage excess iron. Like humans, ferritin and transferrin receptor gene products are expressed by the vampire bat genome and function to maintain iron homeostasis. Ferritin A. The iron response element (IRE) binding protein is able to regulate expression of both ferritin and transferrin receptor genes. What feature of these genes allows for specific regulation by the IRE binding protein? B. How is activity of the IRE binding protein regulated? C. In an environment with excess iron, what levels of mRNA and protein do you expect to detect of Ferritin and Transferrin receptor? Briefly explain. Explanation Transferrin receptor RNA levels ( ) high ( ) low ( ) high ( ) low Protein levels () high levels ( ) low levels () high levels ( ) low levels
3. Regulation of cellular metabolism by insulin requires activation of the insulin-receptor substrate protein-1 (IRS1). Some individuals who have type 2 diabetes mellitus have mutations in the IRS1 gene. Which of the following normal steps in insulin signaling is most likely to be impaired by these mutations? OA) Cleavage of IRS1 by the insulin receptor OB) Phosphorylation of IRS1 by the insulin receptor OC) Production of inositol 1,4,5-trisphosphate by IRS1 D) Stimulation of a G protein by IRS1 E) Synthesis of diacylglycerol by IRS1
Many human cancers result when a normal gene mutates and leads to uncontrolled growth (a tumor). Genesthat cause cancer when they mutate are called oncogenes. Chemotherapy is effective against many tumorsbecause it targets rapidly dividing cells and kills them.Unfortunately, chemotherapy has many side effects,such as hair loss or nausea, because it also kills many ofour normal cells that are rapidly dividing, such as thosein the hair follicles or stomach lining.Many scientists and large pharmaceutical companiesare excited about the prospects of exploiting theRNAi pathway to selectively inhibit oncogenes in lifethreatening tumors. Explain in very general terms howgene-silencing therapy might work to treat cancer andwhy this type of therapy would have fewer side effectsthan chemotherapy