5. DNA polymerase synthesize 100 nucleotide/second and making only 1 error/107 nucleotides in a human cell. 99% of the errors are corrected by a mechanism called mismatch repair resulting in only 1 mistake/ 10⁹ nucleotides (1 in 1 billion). If the human genome size is 3.2x 10¹¹ (320 billion), how many mutations are introduced after each DNA replication? A. 0.32, B. 320, C. 32000, D. 3.2 million

5. DNA polymerase synthesize 100 nucleotide/second and making only 1 error/107 nucleotides in a human cell. 99% of the errors are corrected by a mechanism called mismatch repair resulting in only 1 mistake/ 10⁹ nucleotides (1 in 1 billion). If the human genome size is 3.2x 10¹¹ (320 billion), how many mutations are introduced after each DNA replication? A. 0.32, B. 320, C. 32000, D. 3.2 million

Name: 5 5. DNA polymerase synthesize 100 nucleotide/second and making only 1
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 5 5. DNA polymerase synthesize 100 nucleotide/second and making only 1error/107 nucleotides in a human cell. 99% of the errors are corrected by amechanism called mismatch repair resulting in only 1 mistake/ 10⁹nucleotides (1 in 1 billion). If the hum

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

1. In not more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for DNA replication? 2. In not more than 200 words, explain the special mechanism used to replicate chromosome ends? 3. The human genome 3.4Gb would be 2.3 meters long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell of minuscules proportions? You may add a diagram to your answer. 4. In not more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
4. (2 points) Pseudomonas aeruginosa's circular chromosome is 7.5x106 bp long and the replication fork in Pseudomonas aeruginosa moves at a constant 1000 nt/s using bidirectional replication. Approximately how long will it take a P. aeruginosa to replicate its own genome?
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
1.Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia which may contribute to diabetes. Identify the amino acid replacement from these mutations. 2.Approximately 18% of the double-stranded DNA of the insulin gene is adenine, what are the percentages of the other bases? 3.The insulin gene (double-stranded DNA with 666 nucleotide). Given that 120 nucleotides of the DNA has the adenine bases, how many nucleotides contain thymine, guanine and cytosine? Given that information, can you determine the bases composition of the m-RNA? If so, what is it?
1. Drag each of the following events according to their ability to create spontaneous mutations vs. induced mutations. Nucleotide misincorporation during DNA replication Tautomer shifts of DNA bases Ultraviolet light Alkylating agents 5-Bromouracil Spontaneous Mutation Induced Mutation 2. After ONE round of DNA replication in Meselson and Stahl's classic experiment, ________. both the conservative and the semiconservative models were still possibilities the conservative model was conclusively proven to be incorrect the semiconservative model was conclusively proven to be the correct one all three models of replication were still possibilities the dispersive model was conclusively proven to be incorrect
1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3. Think about what happens at the replication fork. If the gene for helicase is mutated, what part of replication will be affected and how? 4. There are three common types of chemical changes that can damage DNA at any time post-replicatively. In basic terms, name and describe any two of the three types of damage. please help me quick
Give 1 example of diseases arising from each of the following mutations and explain each. Point mutation Frameshift mutation Calculate for the DNA concentration. The absorbance at 260 nm is 0.7 at 1:30 dilution; the absorbance at 320 nm is 0.1. Is the DNA isolated of good quality? The absorbance at 260 nm is 0.7; the absorbance at 280 nm is 0.1; the absorbance at 320 is 0.01. If you do an absorbance reading after plasmid purification and get an A260/A280 of less than 1.8, how could you further purify the sample to get rid of the protein contamination? Is it always necessary to have completely pure DNA? What are some cases where it would or would not be?
12. Shown below are three possible mechanisms for DNA replication. Identify which each kind is (semiconservative, conservative, or dispersive). I Which model is this? (select one) A. Semiconservative Conservative Dispersive Semiconservative Conservative Dispersive Semiconservative Conservative Dispersive B. C. XXX< XXXXXX XXX< x< XXXXXXXX XXXXXXXxXxXx XXXXXX MXXXXX XXxxxxxX XXXXXX
3. Imagine that the double-stranded DNA molecule shown was broken at the sites indicated by spaces in the sequence, and that before the breaks were repaired, the 11 base pair DNA fragment between the breaks was reversed (inverted). What would be the base sequence of the repaired molecule? Explain your reasoning. 5' TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGTGCGTACÁC 3' 3' ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCACGCATGTG 5'
2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA 5'GCTTGATCAGCTAGTCCATC GATCGGTCCTCGGAGCCCATTAAGGTAGC 3' DNA 5' 3'CGAACTAGTCGATCAGGTAGCTAGCCAGGAGCCTCGGGTAATTCCATCG mRNA 5' Protein Alanine Arginine Aspartic Acid ASP Asparagine ASN Cysteine CYS Glycine Glutamic Acid GLU Glutamine Histidine Isoleucine Leucine Lysine ALA Proline Serine ARG GLY GLN HIS ARDNUGEO H А с ISE I LEU L LYS K Methionine MET M Phenylalanine PHE F PRO P Tyrosine Tryptophan TRP Valine VAL SER S Threonine THR T TYR Y <हर First letter UUU Phenyl- UUC alanine G UUA UUG CUU CUC CUA CUG A AUA AUG AUU AUC Isoleucine GUU GUC Leucine GUA GUG Leucine Methionine; start codon Valine UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter Serine Proline…
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
2. For each DNA repair process in column I, list all characteristics from column II that correctly describe that process. I II 1. RecA protein participates. 2. Damaged nucleotides are removed by nick translation (a) Nucleotide excision repair (b) Photoreactivation (c) Base excision repair (d) Recombinational repair (e) SOS-driven error-prone repair (f) Alkyltransferase repair (g) Mismatch repair (h) Double-strand break repair 3. A free radical mechanism is involved. 4. The repair enzyme functions only once. 5. The key enzyme contains a bound folate cofactor. 6. No bases or nucleotides are removed from the DNA. 7. Deficiency of this enzyme in humans greatly increases the risk of skin cancer. 8. This system is chiefly responsible for the mutagenic effect of ultraviolet light. 9. The first enzyme in this pathway cleaves two phosphodiester bonds. 10. This process begins up to 1 kbp away from the site to be repaired. 11. DNA ligase catalyzes the final reaction. 12. This process also occurs…