i struggled with my homework and i need help 14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to C-terminus, of the polypeptidethat would be produced by the transcription and translation of DNA with a sequence of 3'-TACATATGGGGTACT-5'.CAUTION: In this question, you were given the sequence of DNA, not mRNA.●HINT:STEP 1: Use the given sequence of DNA to determine the sequence ofmRNA that would be made in the transcription process.STEP 2: Use the sequence of mRNA from STEP 1 to determine the sequence of aminoacids in the polypeptide that would be made during the translation process.

Here we are given the 3'→5' directing strand of the DNA . This strand is the template strand. During…

Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to C-terminus, of the polypeptide that would be produced by the transcription and translation of DNA with a sequence of 3'-TACATATGGGGTACT-5'.

Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to C-terminus, of the polypeptide that would be produced by the transcription and translation of DNA with a sequence of 3'-TACATATGGGGTACT-5'.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Arachidonic acid, eicosapentaenoic acid, or dihomo-gamma-linolenic acid undergo reactions that…

A: The complete form of NSAIDs is Non-steroidal anti-inflammatory Drugs. These drugs are a class of…

Q: Which of the following statements regarding ketone body formation is not true? the two other ketone…

A: Ketone bodies are metabolic products that are produced during breakdown of fatty acids.These are…

Q: Provide for each amino acid the names that will uniquely identify all ionisable groups at pH 11.0…

A: Amino acids are organic compounds that are the building blocks of proteins. They contain an amino…

Q: 13. Observe the diagrams below. Which sugar(s) is(are) epimers of xylose? Specify the carbon that is…

A: Stereochemistry involves the study of the spatial arrangement of atoms that form the structure of a…

Q: b) The hydrolysis of ATP is directly coupled to H* transport and the stoichiometry of the transport…

A: To determine whether the transport of H+ into the stomach is thermodynamically favorable at 37 °C,…

Q: 22. 2-deoxy-D-glucose is an inhibitor of glycolysis. a) What does the structure of 2-deoxy-D-glucose…

A: Carbohydrates, along with proteins and fats, are one of the three basic macronutrients that produce…

Q: -fatty acid synthesis RNA -> DNA Necessary to make RNA nucleotide G3P F6P &

A: Glucose-6-phosphate is a sugar molecule that is an important intermediate in several metabolic…

Q: Protein Concept Map Add these terms to your concept map should include these concepts and details:…

A: Proteins are complex macromolecules that are made up of chains of amino acids bound by peptide bond.…

Q: What are the key processes that produce ATP through substrate-level and oxidative phosphorylation in…

A: ATP (adenosine triphosphate) is the primary source of energy for eukaryotic heterotrophs and is…

Q: Which of the following group(s) can be found in both an amino acid and a protein? a. Rgroup (side…

A: Proteins are composed of lengthy chains of amino acids joined together by peptide bonds. A protein's…

Q: Draw the Fischer projection for L-glucose. Drag the appropriate labels to their respective targets.…

A: Fischer projection is a way of representing the three-dimensional structure of a molecule in a…

Q: You are studying a novel amino acid. It has an alpha-amino and an alpha-carboxylic group, and an…

A: The titration curve of an amino acid shows the change in pH as an acid or base is added to the…

Q: 5. Some bacteria (extremophiles) live near hydrothermal vents in the ocean, where they thrive at…

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: What inducible nitric oxide synthase do in the respiratory burst?

A: Respiratory burst is a phase that involves rapid release of Reactive Oxygen Species (ROS) by immune…

Q: 5.4 How does glycogen breakdown contribute to energy homeostasis in the body? What are the key…

A: Glycogen is a complex carbohydrate that is the predominant form of glucose storage in both animals…

Q: 100 7.0 0 37 1 0 Relative Percent Oxygen 0 25 50 75 100 pH of intermembrane space 0 3.5 7 10.5 14 0…

A: Glycolysis is the process that converts glucose into pyruvate. After glycolysis, the pyruvate is…

Q: Need help, please.

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: Provide the correct three-letter abbreviation for the following amino acid: O H₂N-CH-C-OH CH₂ CH₂…

A: Amino acids are the building blocks of proteins. They are organic compounds composed of an amino…

Q: Km of LDH with substrate 1 is 60 M and Km with substrate 2 is 45 M. The enzyme has a higher affinity…

A: LDH stands for Lactate dehydrogenase, which is an enzyme found in many organisms, including humans.…

Q: Classify each structure as D or L.

A: Molecules with chiral carbons can exits in different stereoisomeric forms, like the L and D…

Q: Describe the unique fate of organic carbon and phosphorus during sequential anaerobic-aerobic…

A: Sequential anaerobic-aerobic cycling refers to a wastewater treatment process that involves…

Q: Draw the catalytic mechanism of the reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase…

A: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is an enzyme that belongs to oxidoreductase class…

Q: Give typed full explanation not a single word hand written otherwise leave it

A: The basic metabolic route known as the tricarboxylic acid (TCA) cycle, sometimes referred to as the…

Q: 5 Results in 8 10 6 T cell receptor complex Binds to 19 १ Results in H Activated ZAP-70…

A: T-cells, also known as T-lymphocytes, are a type of white blood cell that play a critical role in…

Q: What are the overall benefits/consequences of the Human Genome Project and the ability to quickly…

A: DNA sequencing is the process of determining the exact order of nucleotides (A, C, G, T) in a DNA…

Q: Analyze the reaction below and identify the major class of enzyme that catalyzes the the given…

A: Enzymes are biological catalysts that increases the rate of biochemical reactions. The enzymes can…

Q: The researchers did not study the effects of NADH, ADP and ATP on the enzyme. Given what you know of…

A: Enzyme are proteins molecules that catalyse the biochemical reactions. They are very crucial for…

Q: Draw both possible disaccharides of D-psicose and D-mannose that are joined by an α(1→4) glycosidic…

A: A carbohydrate in which the anomeric hydroxyl group (hydroxyl group attached to the C1 carbon) is…

Q: (a) ribose 5-phosphate from glucose 6- phosphate without the concomitant generation of NADPH? (b)…

A: Stoichiometry involves the relationships between the reactants and/or products in the chemical…

Q: The redox carriers are grouped into respiratory chain complex (A) In the inner mitochondrial…

A: The answer explains the location of redox carriers involved in oxidative phosphorylation in…

Q: Consider the fatty acid arachidonic acid, which has the structure shown below. Which of the…

A: Arachidonic acid is a 20-carbon fatty acid. It has 4 double bonds in its structure in the cis…

Q: DNA and RNA have very similar primary structures, yet their secondary and tertiary structures are…

A: DNA and RNA are polynucleotide chains. DNA stands for Deoxyribose Nucleic Acid while RNA stands for…

Q: Consider the following metabolic reaction: 2-Phosphoglycerate → 3-Phosphoglycerate This reaction is…

A: Metabolism refers to the set of chemical reactions that occur within an organism to sustain life.…

Q: Question 3 Explain the steps of lipid (fat) digestion in the small intestine (explain the…

A: Simple fats or Fat are triglycerides. Triglycerides or triacylglycerols are fatty acid esters of…

Q: Plus pole pH 11.0 Middle of Paper Minus pole Aspartate Lysine Leucine Histidine Example amino acic

A: Proteins are large, complex molecules that are essential to the structure and function of cells,…

Q: A laboratory technician has been tasked to generate a solution for an enzymatic reaction. The…

A: Stock solution is the given solution present in lab. From the stock solution, we make the working…

Q: 6. Is reaction below an oxidation reaction or a reduction reaction? 7. Does this reaction produce…

A: In an oxidation reaction, the atom, ion, or molecule loses electrons. In a reduction reaction, an…

Q: Using good details, compare and contrast the pairs of different biochemical reactions. Create your…

A: The types of biochemical reactions that takes place within lifeforms are numerous. Oxidation and…

Q: Which of the following are pyrimidines? Select one: A. adenine and thymine B. cytosine and thymine…

A: The building blocks of DNA are called nucleotides, and each one consists of three elements: a…

Q: 8) Adrenergic receptors are the a. G-protein coupled receptor b. Ligand-gated ion channel c.…

A: Receptors are specialized proteins found on the surface of cells or within cells that are…

Q: In cellular metabolism a nucleotide frequently becomes attached to a sugar in order to Select one:…

A: An example of nucleotides being attached to a sugar during cellular metabolism is the formation of…

Q: Given the active site below, which best describes the mechanism(s) of catalysis? 1 5 NH i 2 Mn2 "H₂N…

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: In the extraction of DNA from Animal cells (for example Blood in Humans), does incubation time with…

A: Proteinase K is an enzyme that breaks proteins and other peptides. Hence this enzyme is used to…

Q: Which of the following is not a soluble enzyme? VLCAD O KT that acts on an eight carbon fatty acid…

A: Soluble enzymes are enzymes that are capable of dissolving in water or other solvents, such as…

Q: When milk gets sour, it curdles. What are the "curds?" Be sure to describe the "curds and what…

A: Milk can be defined as water in oil type emulsion in which fat molecules disperse in water. Milk…

Q: 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a…

A: Hi! Thank you for the question. since you have not mentioned which part you are looking for, so we…

Q: Identify which of the following structural polysaccharides (amylopectin, amylose, glycogen,…

A: Carbohydrates are molecules made up of carbon hydrogen and oxygen with hydrogen to oxygen ratio…

Q: Could you help me with part F to H of the mechanism?: Using curved arrows, show the mechanism of…

A: Arrow pushing mechanism tells us the mechanism by which reactions take place. Each curved RED arrow…

Q: By analysis of the kinetics of interconversion of (1-13C]FBP and [6-13C]FBP and the appearance of…

A: Anaerobiosis is the phenomenon of existence of life under anaerobic (absence of O2) conditions.

Q: Clinical and biochemical characteristics of jaundice by indicators: indirect bilirubin, direct…

A: Jaundice is a condition marked by excess bilirubin in blood. This leads to eyes and skin turning…

Question

i struggled with my homework and i need help

14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to C-terminus, of the polypeptide
that would be produced by the transcription and translation of DNA with a sequence of 3'-TACATATGGGGTACT-5'.
CAUTION: In this question, you were given the sequence of DNA, not mRNA.
●
HINT:
STEP 1: Use the given sequence of DNA to determine the sequence of
mRNA that would be made in the transcription process.
STEP 2: Use the sequence of mRNA from STEP 1 to determine the sequence of amino
acids in the polypeptide that would be made during the translation process.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Transcription followed by translation

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
The gene encoding the E. coli enzyme enolase begins with the sequence ATGTCCAAAATCGTA. What is the sequence of the RNA transcript specified by this part of the gene? (5') (3¹')
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.