4. Apolipoprotein B is a protein that binds lipids and carries them around the body. One of the two main isoforms of this protein is Apolipoprotein B-100, which is a largepolypeptide, consisting of 4,563 amino acids.A. Apo B-100 is synthesized in the liver. How long will it take a liver cell to translate an mRNA coding for Apo B-100?B. The error rate of translation is 1 in 10,000. What fraction of Apo B-100 proteins are synthesized without any errors?C. The "average" protein is about 250 amino acids long. What fraction of such proteins are synthesized without any errors?

The rate of translation varies amongst prokaryotes and eukaryotes. In prokaryotic cells, this rate…

Answered: 4. Apolipoprotein B is a protein that…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Which value would change most ifthis label were for skim milk insteadof whole milk: grams of fat, gramsof total carbohydrate, or grams ofprotein?
Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize mRNA containing A's and G's only (poly-AG in random order). 2. Convert the amino acid Glutamic acid (Glu) on its tRNA to the amino acid Glutamine (Gln) as shown below. 3. Mix your poly-AG RNA, your artificial tRNA, and cell extract (contains ribosomes, amino acids, all normal tRNAs, and the energy source for translation). Phe Tyr GAA GAA Glutamic acid (Glu) is encoded by GAA and GAG, while Glutamine (Gln) is encoded only by CAA and CAG. What does the outcome of this experiment tell us about translation? Multiple codons code for each amino acid. An amino acid is selected based on the identity of the tRNA. The ribosome does the translation, i.e. it selects the amino acid regardless of the identify of the tRNA. The ribosome reads mRNA 3 bases at a time.
Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C. MRDMW-
A principle function of 5' and 3' end modifications of eukaryotic mRNA is: a. to ensure that all nucleotides are phosphorylated b. to protect RNA from nucleolytic degradation c. to guide the removal of introns d. to serve as binding sites for translation release factors
1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no protein has a continuous line of more than 200 phenylalanines in its structure. Why is this so? A. RNA splicing occurs and removes the noncoding sequences. B. The poly-A tail and 5' GTP cap do not translate into proteins. C. The adenines are reabsorbed by the cell and help to form other forms of RNA. D. The tRNA does not recognize the poly-A tail.
1.List three different mRNA sequences that could encode the amino acid sequence histidyl-alanyl-arginyl-seryl-leucyl-valyl-cysteine.
3. Figure 2 illustrates how Pitx1 transcription is regulated in different tissues. The center image is that of a stickleback embryo. The drawings in the surrounding boxes show the Pitx1 gene region and activator proteins present in the jaw, pelvis, eye, or pituitary tissues. a. List all the tissues shown in Figure 2 that express the Pitx1 gene. b. If a fish does not produce activator 1 proteins because of a mutation in the gene that encodes those proteins, Pitx1 will be expressed in which of the following tissues? c. If a fish does not produce activator 3 proteins, Pitx1 will be expressed in which of the following tissues? d. A fish inherits a mutation in the Pitx1 coding region. This is a nonsense mutation that introduces a premature stop codon, resulting in a nonfunctional protein. Where would you expect Pitx1 to be expressed in this scenario?
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
. Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a. 5’-CGATCTAATG-3’ b. 3’-TGCCGAGCTA-5’ c. 3’-GTAATCTAGC-5’ d. 3’-CATTAGATCG-5’ Coupling of transcription and translation is found where? near type II RNA polymerase activity in prokaryotic cells within the eukaryotic nucleus at the ribosomal complex pls answer
Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…
Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene in yeast is always producing mRNA, but the Gcn4 protein is only made when the cells are starved. A. what is one mechanism by which changes in mRNA levels are not always matched by changes in the protein product of that mRNA?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS