3. Complete the table by providing the important details about the 11 human organ system. What does it do? What organs are involved? Give an example of a time when you are using its system. How can you take care of this system? te
Q: What is the type of inheritance? What is known of the genotype of the male in the above cross? What…
A: Introduction Genetics is frequently used to refer to heredity, which is the passing on of genetic…
Q: Name four differences in the structure d location of DNA VS RNA
A: Introduction The four major types of biomolecules present in our body are carbohydrate, protein,…
Q: Cloning of a gene from the rubber tree can be carried out in bacterial cells. However, for the…
A: Cloning: It refers to the process of creating multiple identical copies of gene-sized pieces of DNA.…
Q: Which is the most important digestive enzyme in gastric juice?
A: Introduction The food you eat has to be broken down by digestive enzymes. These proteins hasten the…
Q: QUESTION 3 Given tubes of equal length and diameter (and the inflow/outfow pressures below), which…
A: Blood flow The local blood flow is the amount of blood that passes through any tissue in a specific…
Q: other diseases like Kwashiorkor Syndrome
A: Kwashiorkor: It is a condition which results from the inadequate protein intake. Initial symptoms…
Q: G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double…
A: The Mendelian gene is a basic unit of the heredity and the molecular gene is a sequence of…
Q: Order: 1 L of 0.9% NS with 40,000 units of heparin over 24 hours. Calculate the rate in mL/h.
A: Heparin is used to prevent or treat certain blood vessel, heart, and lung conditions. Heparin is…
Q: What amino acid does the codon AUG code for? OUAG-methionine (MET) UAC-methionine (MET)…
A: There are 64 possible codons, among them three do not code for any amino acid, known as stop codon.…
Q: 2. Human activity can be very disruptive to an ecosystem. Part of the forest shown in the picture…
A:
Q: With relevant examples where possible, illustrate the classifications of infectious diseases
A: An infectious disease is defined as: "A process that harms a person's health and is brought on by an…
Q: Amino Acid GUA 2 5 Amino Acid-Amino Acid Jeeeee decreet A A A
A:
Q: SUBPHYLUM CRUSTACEA Describe the joint motion of the crayfish cheliped (first walking leg). Compare…
A: Introduction :- The characteristics of a crustacean include: a segmented body with a hard exterior…
Q: You are growing a culture of S. aureus. You know that 9 generations have occurred after 6 hours.…
A: Introduction Binary fission, a process that causes bacteria to divide into two daughter cells, is…
Q: Solution I: 50 mM glucose, 25 mM Tris-Cl (pH 8.0), 10 mM EDTA (pH 8.0) Solution II: ??? Solution…
A: Judging by the Chemical reagents used in the protocol ,it is alkaline lysis method of Plasmid…
Q: Suppose a couple produces 2 children with Prader Willi Syndrome. The older child (Taylor) has two…
A: Prader-Willi Syndrome and Angelman Syndrome are inheritable genetic disorders caused by gene…
Q: What makes transparent softening lotion different from suspension softening lotion? Is it because of…
A: Cosmetics can be differentiated into various sub-categories based on various features, such as:…
Q: Is a chromosomes a one half of a newly replicated eukaryotic chromosome
A: The eukaryotic chromosomes consist of a DNA-protein complex that is organized in a compact manner…
Q: Describe vocational issues for individuals with sickle cell anemia? How do bacteria and viruses…
A: 1- Anemia: Sickel cell break apart easily and die . RBC live usually for 120 days but sickel cell…
Q: The following resembles a pair of eyes looking at you: O a. Lacunae O b. Plasma OC. Albumin O d. Red…
A: Eyes are organs that allow us to see. They take in light from the world around us and send the…
Q: HS IP: FLAG-KDM3A SIA - WT + Lane Number: 1 2 3 S/D 4 5 6 Stat1 FLAG
A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (heat shock (HS) is generally…
Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…
A: Multiplex PCR used in temperature-mediated DNA polymerase in a thermal cycler. Multiplex PCR is…
Q: ATP hydrolysis is exergonic or endergonic
A: Please follow step 2 for detailed explanation.
Q: Draw a strict consensus tree based on your tree and Tree 2. Circle all the polytomies.
A: The strict consensus tree is a tree where the included clades are those that are present in all the…
Q: interpret constructively the given iris scatterplot below
A: The iris is the colored part of the human eye. Muscles in our iris control our pupil that is the…
Q: Red-green color blindness is inherited as a recessive X-linked trait. Individuals who are missing…
A: Colour blindness is a genetic disorder which is inherited as an X-linked recessive condition. It…
Q: 32. What are the two components of tRNA which are important for building a protein? what are…
A: Ribosomes are the one of the most essential organelle which is known for synthesis of proteins.…
Q: Start with a single E/e ; G/g germ cell. It suffers nondisjunction during meiosis II. Which of the…
A: Non-disjunction can takes place in meiosis I or meiosis II where the chromosomes fails to separates…
Q: A: Microorganisms are ubiquitous B: There are more bacteria than fungus in these plates C: All…
A: The bacteria can be cultured on suitable solid and liquid media. Different types of bacteria also…
Q: Numerous hair-like structures extend from the cell membrane of the following type of tissue: O a.…
A: All of the body's interior and external surfaces are covered by a type of tissue called epithelium,…
Q: Which of the following polypeptides (written from their N terminal ends) is encoded by the following…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: Which is true about O-H bonds? A. They are polar and oxygen is the negative end. B. They are polar…
A: O-H bond contains an oxygen and hydrogen atom and this bond is a single covalent bond that carries a…
Q: Describe the process of protein synthesis and trafficking of a protein, a lysosomal hydrolase,…
A: Introduction All cell membranes that exchange lipids and proteins are included in the endomembrane…
Q: Ailee is interested to determine the nucleotide sequence of her bacterial heat shock gene. Hence,…
A: In response to temperature changes, the heat-shock response involves the induction of many proteins…
Q: simple survey instrument for lettuce aquaponics research:
A: General construction this instrument is- Flat wooden trays lined with plastic and filled with…
Q: Liliana is preparing chemically competent cells for heat shock transformation from old batches of…
A: i) E. coli DH5alpha is suitable to propagate plasmid before protein expression. It is a versatile…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: pZERO®-1 is a 2808 bp cloning vector from Invitrogen. This vector allows effective selection of…
A: The PET sequences are simentensously traced to the genome assembly to define the boundaries of…
Q: Use the following information to answer the next question. The Life Cycle of a Fern 1 and 3 2 and 4…
A: *A fern is a vascular plants which reproduce through spores and it doesnt have seeds and flowers.…
Q: 1) Describe the term "conditional lethal mutant" as it relates to rII mutants.
A: INTRODUCTION : r II mutants : Bacteriophage T4 is a virus which is responsible for infection in the…
Q: In detail explain the experiment that helped Hershey and Chase recognize DNA as a genetic material
A: Please follow step 2 for detailed explanation.
Q: 2. If a potted plant is covered with a glass jar, water vapors appear on the wall of glass jar.…
A: Transpiration is the process through which water is evaporated from plant components with stomata,…
Q: the Match the appropriate component of the electrocardiogram with the number on the ECG aka EKG. T S…
A: Electrocardiogram or ECG aka EKG is a tool for evaluating the electrical events during cardiac…
Q: Describe either 1) how you would go about making a goat that produces a silk protein (S) in it's…
A: "Transgenic" is an alternative term used for "genetically modified organisms", these are those…
Q: Explain and give examples of the major functions of the liver.
A: Introduction The liver is the body's second-largest organ. It contains four lobes and can…
Q: the implications of being able to identify phenotype and behavior correlations in different species…
A: Phenotype is the set of observable characteristics of an individual resulting from the interaction…
Q: (iii) (iv) What are the three (3) main cycles in PCR? Discuss the processes at each PCR cycle…
A: Polymerase Chain Reaction ( PCR) is a technique used to make millions or billions of copies of the…
Q: How can the kangaroo rate survive without drinking water? Both physiology and behavior. Name and…
A: Desert-dwelling mammals have extraordinary adaptive features that have frequently and independently…
Q: Which statement is true of topoisomerases? They alter chromosomal condensation by regulating…
A: The DNA is the genetic material in living organisms that is a double stranded coiled macromolecules.
Q: You are a researcher working at Ann's Herbal Farm. The owner of the farm would like you to create a…
A: Cloning is the process of introducing of desired gene or DNA sequence into the host cell to create…
Step by step
Solved in 3 steps
- Select the statement that best describes the primary function of the body system. 1. The Skeletal System a. generates force to move the bodyb. defends against infection and disease and returns fluid to bloodc. breaks down food and absorbs nutrientsd. delivers oxygen and removes wastese. filters the blood and regulates wastesf. contains control center for sensory, motor and higher intellectual functionsg. barricades body from outside organismsh. regulates hormonal secretioni. exchanges gas to obtain oxygen and balances pHj. protects organs, stores calcium and allows movement 2. The Immune and Lymphatic Systemsa. generates force to move the bodyb. defends against infection and disease and returns fluid to bloodc. breaks down food and absorbs nutrientsd. delivers oxygen and removes wastese. filters the blood and regulates wastesf. contains control center for sensory, motor and higher intellectual functionsg. barricades body from outside organismsh. regulates hormonal secretioni. exchanges…1. Complete the following table by indicating where the organs in the organ list are found. Heart Lungs Liver Spleen Intestines Kidneys Spinal Cord Stomach Brain Urinary Bladder Reproductive Organs Pancreas Cavity Dorsal Cavity Ventral Cavity Thoracic Cavity Pleural Cavities Pericardial Cavity Pelvic Cavity Abdominopelvic Cavity Abdominal Cavity RUQ - LUQ - RLQ- LLQ- Organ(s) RegionsThe female ovaries and the male testes are a part ofwhich body system? Can these organs be members of morethan one organ system? Why or why not?
- Match the organ systems in column A with the functions in column B. Place the letter of your choice in the spaceprovided.Column A Column B1. the main system that secretes hormones2. provides an outer covering of the body3. produces a new organism4. stimulates muscles to contract and interprets information from sensoryunits5. provides a framework for soft tissues and produces blood cells in redmarrow6. exchanges gases between air and blood7. transports excess fluid from tissues to blood8. maintains posture and generates most body heat9. removes liquid and wastes from blood and transports to the outside10. converts food molecules into forms that are absorbed11. transports nutrients, wastes, and gases throughout the body a. cardiovascular systemb. digestive systemc. endocrine systemd. integumentary systeme. lymphatic systemf. muscular systemg. nervous systemh. reproductive systemi. respiratory systemj. skeletal systemk. urinary system2. List 5 subspecialties of anatomy and physiology and describe each. 3. Enumerate and discuss the six structural and functional organizations of the human body. 4. List and describe the four tissue types. Give examples. 5. In a table form, classify the organs and the organ system. Relate each of their function. 6. Distinguish between metabolism, anabolism, and catabolism. 7. Provide at least two examples of human responsiveness and human movement. 8. Compare and contrast growth, differentiation, and reproduction. 9. Describe the negative and positive feedback mechanisms. Give an example for each. 10. Using a diagram, discuss the three components of a negative feedback mechanism to maintain homeostasis.3. Complete the table by providing the important details about the 11 human organ system. What does it do? What organs are involved? Give an example of a time when you are using its system. How can you take care of this system? Hu Sty Greatery system
- 13. The cells represented at the orange arrow are ____ located in the ____ of the _____ (name the organ).what are 3 everydays terms of body parts used to describe anatomical structuures; provide the correcr anatomical terms associatd with each common terms6. ORGAN SYSTEMS Familiarize yourself with the different organ systems of the human body. Do this by identifying their general functions and enumerating some representative organs. Organ System Digestive Urinary Reproductive Functions Organs B. INPUT REFERENCES IN AN APA FORMAT VERSION 7th 1. What is a feedback system? Summarize in illustration how it works.
- 7. Using the terms provided, correctly identify all of the body organs provided with leader lines in the drawings below. Then name the organ systems by entering the name of each on the answer blank below each drawing. 1. Key: blood vessels brain heart kidney 2. nerves sensory organ spinal cord ureter 3. urethra urinary bladderIn your own words, give the components of the following body system and the functions of eachcomponents1. Respiratory System.2. Circulatory System3. Nervous Systemconsider anatomical position as needed for determining directional terms) AaBbCcD AaBbCcDc AaBbC AaBbCc Fill-in (give the correct term for each item below; hint: remember to AaB AaBbCc. AaBbCcD T Normal 1 No Spaci... Heading 1 Heading 2 Title Subtitle Subtle Em... Cha agraph Sty Styles Body Fill-in (give the correct term for each item below; hint: remember 1. The head is _?_ to the feet. 2. The liver is part of the ? system. 3. A leg amputation is likely to involve a _?_ cut, or section, through bon 4. My lower back, or_? , is sore. 5. The first finger is_?_ to the hand. 6. The popliteal vein is found in the7. 7. The heart is ? to the right lung. 8. The shoulder is ? to the elbow. 9. The skin is ? relative to the skeleton. 10. Adipose tissue is often just_?_ to the skin. 11. An occipital scar is on the back of the ?. tiguro in the position indicated