25. Which of the following statements is correct? A. Glucose is normally transported into cells by an active transporter called glucose transporters (GLUTS) B. An increase in blood insulin increases the rate of glucose uptake in multiple tissues including liver and brain tissues C. Both A and B D. Neither A nor B
Q: 47. Define group transfer and its role in the cell (Hint: How are amino acids activated by aminoacyl…
A: The genetic code that was copied onto the mRNA is translated into a polypeptide by ribosomes with…
Q: You are a liver cell and have just been given 1 million C25:0 fatty acid molecules (Note: These…
A: As a liver cell, you have the ability to generate net production of glucose through a process called…
Q: 1. Why is nanotechnology likened to creating a statue out of apile of dust?
A: Nanotechnology involves manipulating and arranging individual atoms and molecules to build…
Q: Rank the following energy sources according to the order in which they would be used by skeletal…
A: Skeletal muscle requires continuous demand of ATP during exercise or vigorous activity. These ATP…
Q: 2.2.2. Describe how the sodium-glucose co-transporter achieves its function at the molecular level.…
A: The molecular function of the SGLT2 protein is to couple the transport of glucose with movement of…
Q: Using the language of this unit explain whether the tri-saccharide is a reducing sugar? In your…
A: Reducing Sugar : The term "reducing sugar" refers to a type of sugar that is capable of reducing…
Q: 13. how does covalent modification of enzymes confer regulation of their activity?
A: Biochemical reactions in living things require enzymes. Enzymes must be tightly regulated to…
Q: 28. The concerted model of allosteric regulation is different from the sequential model, because: A.…
A: Binding to substrate model, inhibitor, or activator to one subunit shifts equilibrium between active…
Q: 38. What is true about the rotation of about bonds in a protein backbone? A. The rotation is free…
A: The four types of biological macromolecules are proteins,…
Q: Draw the biosynthetic pathway for tyrosine (anabolism)
A: Tyrosine is an polar amino acid with a hydroxyphenol side group. Tyrosine is a conditional…
Q: How has the discovery of Taq polymerases made PCR more convenient? Taq polymerase has a faster…
A: PCR or Polymerase Chain Reaction is an in vitro technique widely used for amplifying target DNA…
Q: 1. describe genome packaging of prokaryotes?
A: Genome packaging is the compaction and organization of genetic material within cells or viral…
Q: What is the significance of a positive presumptive test?
A: Presumptive test is also known as a screening test. It is an initial or preliminary test that…
Q: H3C CH3 1. After the whole fatty acid molecule is completely broken down, how many molecules of…
A: Beta oxidation is the breakdown of fatty acids into acetyl CoA and other products based on carbon…
Q: GIVE GRAPHICAL MODEL BASED ON GIVEN INFORMATION: There are three elements in this specific model:…
A: Alzheimer's disease is a progressive disease which causes memory loss and dementia. In this disease,…
Q: Describe how the cholesterol from the burger ultimately gets to your liver. In Your answer mention…
A: A metabolic pathway is a series of interconnected chemical reactions that occur within a cell or…
Q: AGE can be used to separate DNA based on its size alone due to which factor? Onon-interacting…
A: AGE is a commonly used laboratory technique in molecular biology and genetics to separate and…
Q: Can all abnormal hemoglobin be diagnosed by electrophoresis? Explain your answer in detail.
A: Electrophoresis means the migration of charged particles under the influence of an electric…
Q: DNA: 3. 2. 1: what is #1? 3: (name the sugar) 2: N bases used RNA: 3. 1: what is #1? 2. 3: (name the…
A: In the given question we have two figures One of the DNA and the other of RNA. DNA consists of a…
Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…
A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…
Q: They want to insert a small sequence into the gene which will be read in the same frame, so that it…
A: The expression of a protein occurs in two steps. Transcription: The gene is transcribed by RNA…
Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…
A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…
Q: 13. Which of the following is true for the induced-fit model of enzyme-substrate binding? A. The…
A: The induced-fit model of enzymes defines that the substrate binds to the active site of an enzyme…
Q: Which of the following catalyzes a step that does NOT produce CO2? Group of answer choices…
A: Malate dehydrogenase catalyzes a step that does NOT produce CO2.Malate dehydrogenase catalyzes the…
Q: The reaction catalyzed by the enzyme Malate Dehydrogenase is an example of oxidative decarboxylation…
A: False. The statement is false. The reaction catalyzed by the enzyme Malate Dehydrogenase is not an…
Q: 5. What science governs nanostructures? Why is it different?
A: Nanoscience, or nanotechnology, studies and manipulates materials and phenomena at the nanoscale,…
Q: i) Draw the first step of lipid hydrolysis using water as a nucleophile OO-P-O LOR₂ OR₁
A: Phospholipids are a type of lipid that is found in cell membranes. A glycerol molecule is connected…
Q: You are attempting to crystallize the head group of a myosin-like muscle protein from a newly…
A: Papain and Trypsin are enzymes very commonly used in animal tissue culture experiments to digest…
Q: You treat some cancer cells with a new therapeutic that you hope will kill them. You run an MTT…
A: The colorimetric assay by using the reagent MTT or…
Q: Identify the nitrogen-containing base, sugar and nucleotide name for each of the following item. AMP…
A: Nucleotides are the building blocks of nucleic acids. Nucleic acids are biomolecules responsible for…
Q: The diagram below depicts the proportion of oxygen bound (e) by haemoglobin at different partial…
A: Hemoglobin is a pigmented molecule present in blood that delivers oxygen to tissues from the lungs.…
Q: During glycolysis, glucose is phosphorylated and then an isomerization reaction produces fructose…
A: Step 1Glucose is a 6-carbon molecule. During glycolysis, glucose is phosphorylated and then an…
Q: The reaction below could be catalyzed by which main class of enzyme (Name and EC# provided)? HO HO…
A: Enzymes are the biocatalysts that are intended to catalyse the biochemical reactions by increasing…
Q: Question with regards to SDS-PAG You are working with a unique protein that has no basic amino…
A: Electrophoresis means migration of charged particles under the influence of an electric field. Gel…
Q: Discuss the major metabolic pathways assigned to your group. Include rate-limiting steps and…
A: Carbohydrate metabolism can be broadly divided into carbohydrate breakdown (catabolism) and…
Q: Which sugar residues and "glyco-antigens" are discussed to play a role in tumorigenesis,…
A: Glycoantigens are carbohydrates that are attached to proteins or lipids. They are important for…
Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Why is working with sticky ends easier compared to working with blunt ends? O sticky ends take…
A: Ends of DNA fragments can be categorized as two blunt and sticky ends which can be called…
Q: D. How many times would you expect to find a specific 20 base pair sequence in the human genome?
A: The total number of base pair sequences in the human genome is 3 billion base pairs or 3 * 109 base…
Q: 6. A scientist needs to prepare an acetate buffered solution at pH 5.0. What is the final…
A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: 27.Arginine is the most basic of the 20 amino acids because its side chain is most cells conditions.…
A: Amino acids are the monomers of proteins. These are the molecules that contain both amino and…
Q: Glucose + H₂O + 0₂ Glucose oxidase H₂O₂ + 4-Aminoantipyrine + Vanillic acid (colourless) Gluconic…
A: UV spectroscopy, also known as ultraviolet-visible spectroscopy or UV-Vis spectroscopy, is a…
Q: Fatty acid beta-oxidation consists of 4 steps that are repeated multiple times. Explain the purpose…
A: Fatty acid beta-oxidation is a metabolic process that occurs within the mitochondria of cells and…
Q: Briefly sketch out the most direct series of steps to make aspartate from glutamate (you do not need…
A: Glutamate can be converted to alpha ketoglutarate, which can enter the TCA cycle.In the TCA cycle,…
Q: For the conditions below relating to Glycogenolysis, explain how glucose release would be affected.…
A: Glycogenolysis is a significant metabolic pathway. It entails the conversion of glycogen into…
Q: Which of the following molecules are nonpolar? proteins muscles cell membranes butanoic acid…
A: To determine if a molecule is polar or nonpolar, we need to consider the molecule's molecular…
Q: You desperately need to join two DNA fragments, one with an EcoRl site and the other with a BamHI…
A: Based on the information provided, the correct statement is:C. You can fill in the ends with DNA…
Q: the class of enzymes to which it belongs to, ii) name the kind of bond that is modified due to its…
A: Enzymes are proteins that catalyse biochemical reactions. Enzymes show high substrate specificity…
Q: Which photosystem (I, II, both or neither) is disrupted by each of the inhibitors? Explain how you…
A: Photosystem I (PS I) is mainly composed of the P700 reaction center, ferredoxin, associated NADP+…
Q: What is the best advise for obtaining 2-log viral inactivation when the needed CT free chlorine is…
A: Various disinfectants are used to clean or free the water from microbes. The parameter which is used…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 26. Which of the following statements is correct? A. Insulin can activate pyruvate carboxylase B. More energy in the form of ATP is required to synthesize glucose from pyruvate than can be obtained from glucose by glycolysis alone C. Fructose-2,6-bisphosphate is a modulator that can stimulate either glycolysis or gluconeogenesis, depending on cellular glucose concentration D. All of the above1.a. Given what you know about glycolysis and gluconeogenesis, does it make sense that insulin activates PDH phosphatase? Why? b.How do vitamins increase to the breadth of chemical reactions available within a biological system?7. Which of the following statements about gluconeogenesis is CORRECT? Select one: a. Glucose-6-phosphatase hydrolyzes glucose 6-phosphate to release glucose into the blood. b. Glucose-6-phosphatase hydrolyzes glucose 6-phosphate and is found in liver and muscle. c. Fructose-1,6-biphosphatase converts fructose-1,6-bisphosphate into fructose-1-phosphate. d. Pyruvate is first converted to phosphoenolpyruvate by phosphoenolpyruvate carboxykinase.
- 1. Insulin.....a. Carries glucose into the muscle cellb. signals the muscle cell to take up glucose c. signals the synthesis of glucose in the liver d. carries lactate from the muscle to the liver 2.In the fasting, state, the Liver helps maintain a normal level of blood glucose by: a. Making ketones and storing them for later.b. stopping glycolysis and using alternative fuels for energyc. speeding up glycolysis because it needs energy to make glucose d. Beginning glycogenesis to build up glucose storageBased on your understanding of the binding of insulin, select all of the following events that you would expect to occur in muscle cells due to insulin binding to receptors.Group of answer choices a. Glycogen synthesis is activated b. PFK is stabilized in the R-state and glycolysis is activated c. GLUT4 (transporters) are increased in concentration at the plasma membrane d. Fructose 2,6-bisphosphate increased levels aid in stabilization of the T-state fructose 1,6-bisphosphatase e. Gluconeogenesis is activated in response to elevated fructose 2,6-bisphosphate levels f. Phosphorylation cascades allow for covalent modifications that would aid in the breakdown of glycogen to allow for increased levels of glucose 6-phosphate in the cell g. Hexokinase is inhibited so glucose will not be brought into the cell in high amounts h. Glycogen breakdown pathway is inactivated7. Which of the following statements regarding the regulation of glycogen metabolism is false? A. Glycogen synthase activity is dictated by its phosphorylation status. B. Glycogen phosphorylase is inhibited by ATP. C. Adrenaline stimulates glycogen breakdown. D. Glycogen phosphorylase is activated by AMP and glucose-6-phosphate. E. Glucagon signals that concentrations of blood glucose are low and leads to breakdown of glycogen.
- Which one of the following statements concerning gluconeogenesis is correct? a. It is inhibited by elevated levels of acetyl CoA. b. It occurs in muscle. c. It is important in maintaining blood glucose during normal overnight fast. d. It is stimulated by fructose 2,6-bisphosphate.4. In primary carnitine deficiency: a. Which of the following (from the list below) will accumulate in the tissues of the affected person? b. Which will be below normal in the blood? Choose all that apply and explain your choice for each. A. Capric acid B. Cholesterol C. Ganglioside GM2 D. Glucocerebrosides E. Glucose F. Ketone bodies G. Sphingomyelin H. Stearic acidA 30 year old man who has type I diabetes mellitus with a blood glucose of 340 mg. One hour after eating he administered a dose of short acting insulin. After treatment what is most likely increased in the liver? a. cAMP b. G6P activity c. PFK 1 d. phosphorylation of pyruvate kinase e. PKA
- Which of the following statements regarding glycogen are true? A. Glucose from glycogen can be metabolized anaerobically B. Approximately 1-2% of muscle weight is glycogen, whereas 10-15% of liver weight is glycogen C. It is faster for the muscle to obtain energy from glycogen than from lipids D. A and B are true E. B and C are true F. Both A, B, and C are trueA deficiency in sorbitol dehydrogenase cause all of the following except: Select one: O a. pathologic alternations related to Diabetes mellitus b. no lactose synthesis O c. lack of sperm motility O d. no fructose synthesis7. During several days, Patient A got a meal with high caloric value, and Patient B- with a low caloric value. What are the differences in the lipid metabolism in these two patients? What is the insulin/glucagon ratio in these patients after a meal? Which metabolic pathways rather activated in Patient A and how is it being controlled? 8. The adipose tissuc is not only store triacylglycerols but also is active endocrine organ. Explain this function of the adipose tissuc. For that: a) explain the sclinical obesity and possible conscouences of the discase: