2. The oskar MRNA is localized in a pre-cellular embryo for future tail development (see Figure A below). Posterior pole Anterior pole (future head) |(future tail) oskar MRNA Figure A Figure B

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: Identify the parts of a gene/transcription unit and identify the parts that are transcribed. The…

A: DNA is the nucleic acid that behaves as a carrier of genetic information in almost all biological…

Q: What would happen to an mRNA produced from a gene that contained a mutation in the 3'UTR region that…

A: Transcription and translation both form a part of the central dogma of molecular biology.…

Q: 3. please answer this asap

A: The goal during this scenario is to match distinct cis-regulatory elements with the relevant deleted…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Write the functions of UTR of mRNA

A: Transcription is the process in which single-stranded RNA molecules are produced by RNA polymerases.…

Q: Which of the following is not an example of translational control of MRNA? Localization bicoid mRNA…

A: Translation is the process of synthesis of protein. The ribosomes, tRNA, rRNA are involved in the…

Q: Many genes important in development are regulated by effecting their mRNA. What is the mechanism…

A: The regulation of gene expression is a fundamental process that underlies many biological phenomena,…

Q: What are functions of the M7G cap? Select all the apply. Slows degradation from the 5' end of the…

A: The process by which mRNA is produced from DNA is called transcription and the process by which…

Q: RNA Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Eukaryotic primary transcripts are split. That is, they are composed of coding sequences for…

Q: Part1: Using the DNA nucleotide sequences for the wild-type and mutant genes in the following…

A: DNA or Deoxyribonucleic acid act as the hereditary material of almost all biological entities. It is…

Q: The individual with Werner syndrome: Makes WRN mRNA that is shorter than wildtype Doesn't make WRN…

A: Werner syndrome is caused by mutations in the WRN gene.ExplanationWhen mutations occur in gene, they…

Q: Which of the following is true at the time introns are spliced our nRNA? O Only the 3' end of MRNA…

A: Introns are defined as noncoding sections of an RNA transcript, or it can be the DNA encoding it.…

Q: b. You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown…

A: DNA is the deoxyribonucleic acid. It is a double-stranded molecule, which consists of two strands:…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables,…

A: This question is completely based on the transcription and translation processes. Transcription is…

Q: You have identified a mutation. In the normal organism the DNA TEMPLATE strand is 5'AGT3' in the…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: Eucaryotic

A: Introduction:-  Heterogeneous nuclear RNA or hn RNA is a term that encompasses various types and…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: 3. Where in the eukaryotic cell does transcription during transcription? occur and what molecule is…

A: Nucleic acid is a macromolecule present inside the nucleus of the cell . In this , genetic material…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: Identify the parts of a matur mich of the following is found in nucleotides 5 can

A: mRNA or messenger RNA are polynucleotide molecules having backbone of ribose sugar and phosphate.…

Q: Using the DNA nucleotide sequences for the wild-type and mutant genes in the following tables,…

A: DNA or Deoxyribonucleic acid act as the hereditary material of almost all biological entities. It is…

Q: If you have an mRNA sequnece below that looks like : 5' cap,  Cytidine, CCUCUUUUCC,  gene,  AAAAA…

A: Messenger RNA or mRNA is a single stranded RNA synthesized from a DNA template by a process called…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: 1. What is RNA? And, how is RNA modified?  2. What are the 3 major steps involved in mRNA…

A: Ribonucleic acid is a molecule similar to DNA. Unlike DNA, RNA is single-stranded.

Q: Please draw the mature mRNA (before it is ready to be exported from nucleus):

A: In addition to their role in genetic information storage and transmission, nucleic acids are also…

Q: Label if each of the fonowing Sequences are present in DNA, pre-RNA andlor MRNA Of eukanyotes :…

A: All the information is present in the DNA that will be required for the synthesis of proteins. In…

Q: d. Where would you find a mutation that affects transcription of this gene? e. Where would you find…

A: A human gene at molecular level consists of several parts like promoter where the transcription…

Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…

A: The protein is synthesized by the translation process. It takes place in the cytoplasm.