1,3-Cyclopentadiene has to be used quickly after it is made, or stored cold. Which reaction below is the reason it has to be used so quickly? 10.1-0 A B C + H₂O HO D + H2O S OH O O C O D A B
Q: Draw a triacylglycerol (triglyceride) made from glycerol, myristic acid [CH3(CH2) 12COOH], palmitic…
A: Step 1: Step 2:
Q: Mr. Gill is attempting to grow some new flowers at home. He knows that flowers and plants alike…
A: Le Chatelier's principle states that if a dynamic equilibrium is disturbed by changing the…
Q: None
A: Here te aldehyde group is more electrophilic compared to the anhydride carbonyl. So the alkyl anion…
Q: Be sure to answer all parts. Enter your answer in scientific notation. Calculate Ke for the…
A: Step 1:-Given the equilibrium equation: 2SO₂(g) + O₂(g) ⇌ 2SO₃(g)We have Kp = 2.5 × 1010 at T = 4.5…
Q: Answer the questions in the table below about this molecule:
A: Step 1:
Q: A 3.0-kg cast iron pan absorbs 1.08 × 105 J of energy as its temperature rises from 20°C to 100°C.…
A: Let's answer each question one by one:Specific Heat Capacity of Cast Iron:We can use the formula…
Q: 17. What can you say about the reaction below? 1. OsO4 2. NaHSO3 ? A. This reaction will generate…
A: Step 1: Step 2: Step 3: Step 4:
Q: please answer in text form and in proper format answer with must explanation , calculation for each…
A: Step 1: Aldol Condensation :Two molecules of an aldehyde or a ketone, containing at least one…
Q: When two molecules collide, which requirements are necessary for a new product to be formed? Select…
A: Step 1: Conditions of collision theory are given below - (i) Molecules must collide with a…
Q: Draw the structures of the major organic product(s) or condition(s) denoted by A to E in the…
A: Step 1:• Mechanism: • In the first reaction, hydroboration oxidation reaction occurs in which…
Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA
A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…
Q: 15. What is the pKb of CN-, the conjugate base of HCN? 228 a. 10.40 b. 4.60 по ai.VI noitesu ni ODH…
A: CN- is the conjugate base of HCN because HCN can donate a proton (H+) to become CN-.pKb is the…
Q: What would be the major product(s) of the following reaction? །། Brtw HO 20°C (CH3)2CHCH20 I…
A: Tertiary alkyl halide in the presence of alcohol will either undergo SN1 (nucleophilic substitution…
Q: CH3 CH₂CCHCH2CH2CH3 CH, C1 CH3 CH3CCHCH2CH2CH3 CH3 Cl H₂O frío Mecanismo: H₂O calor
A: Step 1:Reaction 1: The first reaction occurs at a lower temperature (frio), where simple SN1 type…
Q: The type your answer... type your answer... of a solution is a measure of the concentration of ions…
A: Ionic Strength (I):Reflects the total concentration of dissolved ions in a solution.Accounts for the…
Q: HO 义 H2SO4 E + F major minor G Identify and label the nucleophile and electrophile
A: Approach to solving the question:Detailed explanation:Examples: Key references:
Q: how to synthesize this?
A: 1. First, we need to halogenate the alpha carbon (the carbon, adjacent to the carbonyl carbon)We…
Q: Predict the major organic product(s) of the reaction shown below. OH A only B only C only H₂O - ? OH…
A: The major product will be A because addition of -OH takes place according to Markonikov's…
Q: (a) Compute the voltage at 25°C of an electrochemical cell consisting of pure cadmium immersed in a…
A:
Q: Zinc oxide can be used for treating certain skin conditions. Determine the molar mass of ZnO.
A: The molar mass of zinc oxide, ZnO, is the sum of the molar masses of zinc and oxygen. With zinc…
Q: Kinetics and Equilibrium Calculating an equilibrium constant from a heterogeneous equilibrium...…
A: Step 1: Step 2: Step 3: Step 4:
Q: :$;$;););):$::$:&&:$$;$;;$
A: Step 1: Information: As their are different types of reaction performed with alkyne gives diffrent…
Q: Please answer 22
A:
Q: Step by step full solution
A: Step 1: The electrophilic carbon atom (the carbon atom that has a chlorine connection to it) is…
Q: Name this with the IUPAC
A: In case of any doubt please feel free to ask.
Q: Complete this acid-base reaction, and label the acid, base, conjugate base, and conjugate acid.…
A: Step 1:Step 2:
Q: Question 2. A homeowner uses 4.00 x 103 m3 of natural gas in a year to heat ahome. Assume that…
A:
Q: Listen For the equilibrium system represented by 2C(g)+D(g) Elg), the equilibrium constant (Kc) is…
A: To calculate the final (equilibrium) concentrations of C and D, use ICE table to relate quantities…
Q: None
A: Approach to solving the question: Detailed explanation: Examples: Ke
Q: 17.43 Draw the products of each reduction reaction. NaBH4 CH3OH OH [1]LIAIH [2] H₂O [1]LIAIH4 OH d.…
A: (a)(b)(c)(d)
Q: What is the major product? он HOT OH LOH OH LOH он HOT NHz OH Он NV
A: Step 1: Step 2: Step 3: Step 4:
Q: 5.30 The average enthalpy change of vaporization of benzene between room temperature and the normal…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Answer the questions in the table below about this molecule:
A: Detailed explanation:Identification of the Molecular Structure: The molecule presented,…
Q: Please draw out neatly ;&;&;$;$;$$;!!;!;!
A:
Q: 1, Solve the Schrodinger Equation (SE) of particle in a well (PIW) using complex exponential…
A: The image you sent depicts a step to solve the Schrodinger Equation (SE) for a particle in a well…
Q: Show work, thank you!
A:
Q: 2. When 4.21 grams of potassium hydroxide are added to 250. mL of water in a coffee cup calorimeter,…
A: Please see the attached image for the solution. If there are queries, please do not hesitate to…
Q: balance this equation : HF(aq) + LiOH (aq)
A:
Q: :&;$;$:$$:$$;$;
A: It seems like you're describing a series of reactions involving bromine (Br2) under various…
Q: below. Draw the structure of each intermediate for each reaction. You can use anything with a…
A: Step 1:Step 2:Step 3: Step 4:
Q: None
A: The reaction is to be balanced in the basic medium, so we will use the charge balance method:First…
Q: Sagar
A: Step 1:Entropy is the measurement of disorderness or randomness. Gaseous particles have more…
Q: egg : 4) Provide a detailed mechanism for the dehydration of 3-methyl-2-butanol with aqueous…
A: Step 1: Step 2: Step 3: Step 4:
Q: The reaction rate can also be described by the rate lawRate = k [S 2 O 82- ] x [I - ] yThe exponents…
A:
Q: An arctic weather balloon is filled with 40.3 L of helium gas inside a prep shed. The temperature…
A: Approach to solving the question:Please see attached photos for detailed solutions. Thank you.…
Q: 121 (OL) Lab 3 Den... V Layout Search References Mailings Review View Help 1 2 3 5 6 I i Lynette…
A: Given data :Density of aluminium is 2.6989 g/mL.We can convert it to g/cm³, we know 1 cm3 = 1 mL…
Q: None
A: a)Step 1 adds nitro group to para position (methyl is an ortho, para director).Step 2 reduces nitro…
Q: :$;$::):;));:$::$;
A:
Q: Please don't provide handwritten solution.
A: Detailed explanation:Understanding the Relationship Between Isomeric Structures in Organic…
Q: Calculate the solubility of Zn(OH), in water at 25 °C. You'll find Ks sp Round your answer to 2…
A: For No. 1: Zn(OH)2 will dissolve and dissociate based on the following reaction Zn(OH)2⇌Zn2++2OH−…
Step by step
Solved in 2 steps
- 7-55 trans-1-Bromo-2-methylcyclohexane yields the non-Zaitsev elimination product 3-methylcyclohexene on treatment with KOH. What does this result tell you about the stereochemistry of E2 reactions? CH3 .CH3 кон Br H trans-1-Bromo-2-methylcyclohexane 3-MethylcyclohexeneWhat are the reagents A and B in the scheme below? Br CH3 в CH,CH,CH,C-CH, A HgC CHy H;C CH11 What is the missing reactant? CH3 Br LDA -78°C B THF 0 H-C-OCHS с i H-C-H -CH3 D CH3OH
- Elimination reactions of cis- and trans-1-bromo-2-methylcyclohexanes with Eto in ETOH could potentially give the two products, 1-methylcyclohexene (1) or 3-methylcyclohexene (2). Which answer (a-d) indicates the major products for each reaction? Br „Br EtO Eto "CH3 ELOH `CH3 *CH ELOH "CH3 cis trans Select one: a. 2 from the cis and 1 from the trans substrate b. 2 both from the cis and trans substrates c. 1 both from the cis and trans substrates d. 1 from the cis and 2 from the trans substrateWhich carbocation is least stable and which is most stable? Which carbocation can't be rearranged into a tertiary carbocation?The correct sequence of reagents for the following conversion is: Br N T OH Br OH Br
- 7What is the expected major product of the reaction sequence shown below? 1. O3 2. H20 CO2H CO2H CO2H IV B %3D II IV E VBromo cyclopentadiene reacts to form a Witting Reagent (A), but does not react with aldehydes or ketones to give an alkene. Draw A and explain why it does not react with a carbonyl. Br 1. PPh3 2. Base A R H No Rx