10. Messenger RNA often encodes more that one biological activity. These activities can then be selectively released by specific proteases that often recognize: A. disulfide bridges. B. basic amino acid pairs. C. stop codons. I D. proline-glycine-hydroxyproline sequences. E. formxlated methionine.
Q: II. Effect of temperature Observation(Time taken for the disappearance of blue-black colour) Test…
A: Introduction: Enzymes are organic biocatalysts that fasten the rate of chemical reaction that is…
Q: A polypeptide is shown below. Please answer the following questions. OH В A C H;N E H D H a. Match…
A: A polypeptide is a long, unbranched chain of amino acids joined by peptide bonds. To generate an…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Tagatose is ketohexose i.e. it has 6 carbons and is a ketose sugar.
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: In isoelectric precipitation, the amount of protein precipitate (increases, decreases) below the IpH…
A: Isoelectric point is the pH at which the protein carries no net charge and total charge of protein…
Q: Many blood clotting proteins undergo a post-translational modification in which specific glutamic…
A: Post Translational Modifications (PTM) of such complexity is only observed in eukaryotes and not in…
Q: Match the following biogeochemical cycles terms to the correct definiton. In this cycle the…
A: Introduction: The term biogeochemical cycle is a natural process that recycles nutrients from the…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: Explain the biochemical consequences of Glucose-6-Phosphatase deficiency that results in gout due to…
A: The enzyme glucose-6-phosphatase regulates the release of glucose from glycogen stored in the liver.…
Q: C17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correct
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain…
Q: ion. What cause mentioned changes? For the
A: Amino acids are building blocks of proteins which can be divided into two group based on its…
Q: Fat storing cells of vertebrates are called hеpatocytes - asterocytes - adipocytes melanocytes
A: Lipids are easily soluble in nonpolar solvents such as benzene, ether, and…
Q: Cell membranes are composed of a lipid bilayer. How does the type of lipid bilayer affect its…
A: The cell membrane is composed of a phospholipid bilayer.
Q: Which of the following is the primary method by which cyclin proteins are regulated to influence…
A: A. Transcriptional upregulation and translation followed by targeted ubiquitin-mediated degradation…
Q: In electron transport c Select one: О a. 1 АТР O b. 2ATP Ос. ЗАТР O d. None of the abe
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: What are examples of enzymes?
A: Enzymes are nothing but Proteins that help us in our metabolic pathways to increase the rate of…
Q: D. PCR of lacZ GENE 1. You will be preparing a PCR reaction for your "G" and "L" tubes. When…
A: Given Values: The total volume of the PCR reaction tube = 50 μl The total volume of the master mi…
Q: O antigen is a base oligosaccharide that is present in both A and B antigen. O True O False
A: Question 12: Blood group antigens, whather a person has type A, B, AB, or O blood is determined by a…
Q: a. How much ATP is generated in the complete oxidation of glucose in skeletal muscle, taking into…
A: Complete Oxidation of Glucose takes place in multiple steps in different compartment of cells.…
Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…
A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…
Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: Ion exchange chromatography is used to separate molecules based on their net surface charge.
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme…
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: During DNA replication, the double stranded DNA molecules are separated into single strands and…
Q: Which of the following methods can be used to regulate the activity of cyclin-dependent kinases…
A: CDK are the protein kinase which are involved in the regulation of cell cycle.
Q: Question 3 -- / 1 What form(s) of chemical energy are generated during cyclic photo-phosphorylation?…
A: Introduction: Photophosphorylation is the process by which photosynthetic organisms use the energy…
Q: Question 20 он NH но HO" "он cerebroside monoglycosyl ceramide glycosphingolipid O all are correct
A: Phospholipids are compound lipids composed of fatty acids, alcohol, and an additional group. Based…
Q: Please discuss how digitoxin provides a positive inotropic effect and is used to treat congestive…
A: Digitoxin is a cardiac glycoside that is used in the treatment of heart failure. Glycoside are…
Q: What are the main structural features of an amino acid?
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serves as building…
Q: Which of the following is NOT a primary method used to regulate the activity of cyclin-dependent…
A: Cyclin-dependent kinases (CDKs) are the protein kinases which plays a role in regulating the cell…
Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…
A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…
Q: Illustrate and summarize ketogenesis.
A: Ketogenesis is one of the biochemical pathways. The process of ketogenesis occurs in the liver. The…
Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…
A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…
Q: Fill in the blanks in the table below regarding the similarities and differences between two…
A: The replication of DNA involves opening up a double-stranded DNA molecule and creating a…
Q: What is an enzyme in biology?
A: Different types of cells, tissues, and other complex organs make up the human body. To maintain a…
Q: Topic: Photosynthesis Hi. I'm having trouble determining the answer to this question. I would like…
A: Photosynthesis is an anabolic process in which the carbohydrates are synthesized by using carbon…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Sorbitol is a carbohydrate that is classified as a sugar alcohol or polyol.
Q: 4. Apolipoprotein B is a protein that binds lipids and carries them around the body. One of the two…
A: The rate of translation varies amongst prokaryotes and eukaryote. In prokaryotic cells this rate is…
Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…
A: DEAE-cellulose contains an diethylaminoethyl group and is positively charged at neutral pH.
Q: Determine the serial dilution used from the original water sample (100 mL) with 4.8 x 105 CFU as…
A: Introduction: Dilution is the process of reducing the concentration of a solute in a solution by…
Q: ceramide with a single sugar is called? Cerebroside Plasmalogen Sphingomyelin…
A: sphingolipids : found in brain extract, contain a backbone of sphingoid bases, a set of organic…
Q: Explain the 4 roles of enzymes thereby lowering the activation energy
A: An enzyme, by definition, is a protein molecule that acts as a biological catalyst, allowing…
Q: The circulatory system is a O closed network of arteries, veins, and capillaries O an open network…
A: Circulatory system is one of the important systems of the body involved in various processes like,…
Q: GLUCONEOGENESIS Reactant Coenzyme/ Product Cofactor Enzymes
A: The balance between the rate of glucose leaving and entering the blood circulation…
Q: lood group A has A antigen on the red blood cells with anti-A antibodies in the plasma. O True O…
A: Introduction: The ABO blood group system is the most common blood type system in human blood…
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Fractional saturation(Y) is the ratio of concentration of protein-ligand complex to total…
Q: Which of the following contain copper atoms (Cu2*) Select one: O a. Complex II O b. Complex III…
A: There are four enzyme complexes of ETC present in the inner mitochondrial membrane. Complex 1-…
Q: Match lipid structures in column A with its lipid type in column B
A: Lipids are the group of organic components having oily or greasy consistency. Lipids are a group of…
Q: Identify chemical reactions involved in food preparation and preservation. Explain how these…
A: The oldest method of food preservation includes drying, refrigeration and fermentation…
Step by step
Solved in 2 steps
- 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water PhotophosphorylationThe aminoacyl-tRNA synthetase enzymes are responsible for: O A. matching each tRNA with the appropriate mRNA codon. O B. catalyzing the enzymatic step of peptide bond formation during translation. O C. synthesizing tRNA molecules in the nucleus from tRNA genes. O D. adding amino acids to appropriate tRNAS (charging the tRNA). O E. regulating the process of amino acid synthesis.
- 1. Identify the term being asked by the statement: a. It describes mRNA that results in a single translation of several genes at a time. b. It guides the newly formed polypeptide/protein to the endoplasmic reticulum for further processing c. These are Nucleotide sequences resulting in stem loop structures in the mRNA , and subsequent falling off of the RNA polymerase from the mRNA strand. d. It is a A secondary structure in proteins where the amino acid chains aligned side-by-side with every other chain situated opposite the other, with chains being held together by hydrogen bonds1. TRUE OR FALSE a) Eukaryotic mRNA contains the message from the DNA for the synthesis of one polypeptide. b) The 2'OH in the sugars of RNA is advantageous to the molecule to facilitate its hydrolysisAll of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the 5’ end B. have stems and loops C. are all encoded by a single gene D. an anti-codon of 5’AAC3’ corresponds to a codon of 3’UUG5’ E. exhibit distinctive 3D folds F. are acted on by 64 different aminoacyl synthetases G. are charged with amino acids by peptidyl transferase
- The degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and single nucleotides B. The fact that tRNAs can bind to mRNAs at the same time they transfer amino acids to a growing polypeptide chain C. The fact that there is only one start codon D. The fact that the code is non-overlapping E. The fact that more than one codon specifying an amino acid F. None of the above1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
- 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulumWhich of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.