. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantprotein

Q: Find the complimentary strand of bases for CGCTGACC O ATCAG AT G O TAGGACGT GCGACTGG

A: Deoxyribonucleic acid (DNA) function as one of the genetic material in both prokaryotes and…

Q: Vhich type of mutation occurs when a DNA sequence changes from GGA TCA CCG GAA... to GGA TCG CCG…

A: Step 1: A mutation is a change in our DNA sequence that occurs as a result of errors during DNA…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: 22-69 Indicate whether each of the following statements relating to protein synthesis is true or…

A: The process in which the formation of proteins occurs is called protein synthesis. It is the main…

Q: They want to insert a small sequence into the gene which will be read in the same frame, so that it…

A: The expression of a protein occurs in two steps. Transcription: The gene is transcribed by RNA…

Q: Question 10 Review mutations. Match the term and its description. Each term can only be used once.…

A: change in just one nucleotide pair is called a point mutation  the mutation that does not have an…

Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…

A: Given , the  coding strand is     5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: Which of the following best represents the amino acid sequence found in normal adults with the HBB…

A: The Hemoglobin beta chain gene consists of code for 146 aminoacid sequences, where each amino acid…

Q: Predict how the mutation in the seventh codon of normal hemoglobin changing it from ctc to act,…

A: The change of the codon from CTC to ACT is a point mutation at the seventh codon of haemoglobin.…

Q: Mutated DNA Sequence #3 T A C A C C T TAG C GACGACT... What's the mRNA sequence? (Circle the change)…

A: DNA sequencing is the process of determining the nucleic acid sequence in the order of the…

Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…

A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…

Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…

A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…

Q: Question: Which of the following statements about point mutations is true? O Frameshift mutations…

A: It occurs when there is mutation in the single base pair. Either it is deleted, added or replaced by…

Q: How would a mutation like R167Q within a protein such as Human yD Crystallin affect its function and…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: 1. Pro A wild-type strain of bacteria produces a protein with the amino acid proline (Pro) at one…

A: From the genetic code we can find the codons of the following amino acids mentioned in the question.…

Q: That's okay; you're just stoked to be doing international collaborative research     That's okay;…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…

A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…

Q: Examine Figure 16.2b. Why do you think the motif of the DNA-binding protein shown is called a…

A: Deoxyribonucleic acid (DNA) binding proteins are proteins that attach to single stranded or double…

Q: an a missense mutation of proline to histidine be made with a G • C → A • T transition-causing…

A: A change in the genomic sequence of an organism is referred to as a mutation. It can be caused due…

Q: Biology textbooks once taught the conceptof “one gene, one protein”—that a gene isa segment of DNA…

A: According to the one gene one protein hypothesis that was proposed by Beadle and Tatum, a segment of…

Q: Which of the following would NOT be the right match? O Sickle cell anemia, a point mutation nonsense…

A: Mutations These are defined as the change in the sequence of DNA. These are due to the DNA copying…

Q: All of the following pairs are well-match, except one: O Addition of Tubulin dimers occurs more…

A: Microtubules are dynamic structures that are constantly being polymerized and depolymerized. The…

Q: What new amino acids might be substituted for proline after treatment with 5-BUDR?  (This mutagen…

A: Any physical or chemical or biological agent capable of altering DNA sequences is called a mutagen.…

Q: If you were to design a synthetic protein that would be used to increase support in synthetic heart…

A: Introduction:- The mitral, tricuspid, pulmonary, and aortic valves are the four heart valves that…

Q: Explain why a defi ciency of the vitamin folic acid could lead to undermethylation of histones and…

A: DNA methylation is a commonly used mechanism for epigenetic gene regulation. S-adenosylmethionine…

Q: since red blood cells lack nuclei--which embeds the DNA that is required for transcription, how do…

A: Introduction: An oxygen-binding protein called hemoglobin is present in erythrocytes and is…

Q: A significant number of mutations in the HBB gene that causehuman β thalassemia occur within introns…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: Chain termination/Nonsense mutation - no a.a. that corresponds to a new base sequence; results to…

A: Introduction:- Mutations are defined as any kind of heritable change occuring in the genetic…

Q: A set of nucleotides in an original DNA strand reads: TAC GCG AAT Transcribe this short DNA…

A: Gene is the sequence of nucleotides in a DNA. It encodes a protein.

Q: 1 Foundations Cell Molec The first 17 amino acyl residues in human preproinsulin are…

A: Colinearity simply refers to the relationship between the length of a DNA sequence in a gene and the…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: The human proteome contains a much greater variety of proteins than would be predicted from the…

A: The total set of proteins expressed by the human genome, or the proteome, is immensely complex and…

Q: What's the mRNA sequence? amino acid sequence?

A: Mutated DNA Sequence - TACGACCTTGGCGACGACT mRNA Sequence - AUG CUG GAA CCG CUG CUG A Amino Acid…

Q: Of all the genes in the human genome, the ones withthe most characterized Alu insertions are those…

A: Introduction  Transposons are the short highly repeated DNA sequence present in heterochromatic…

Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…

A: DNA is two stranded structure which make it own strand via  replication process . It comprises of…

Q: What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND…

A: DNA and RNA are important for cell function as DNA provide the information for the cell's…

Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…

A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…

Q: . Can a missense mutation of proline to histidine bemade with a G • C → A • T transition-causing…

A: A missense mutation is a point mutation that occurs in a codon that codes for a different amino acid…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction  DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: Given the sequence of triplet codons: 5′-TAC AAA ATA CAG CGG-3′, write out one of each: transition;…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine (A…

Q: 1.List three different mRNA sequences that could encode the amino acid sequence…

A: Amino acids are the building blocks of polypeptide and proteins.  The process of making of…

Q: "Studies of Human Hemoglobin Established That One Gene EncodesOne Polypeptide" Define this ?

A: The theory that every gene is accountable for the synthesis of one polypeptide.