. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantprotein

Q: A protein substrate is known to be multi-monoubiquitinated. The control lane "C" in the SDS-PAGE gel…

A: The proteins are separated on the basis of their molecular weight by the technique known as Sodium…

Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…

A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…

Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…

A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…

Q: They want to insert a small sequence into the gene which will be read in the same frame, so that it…

A: The expression of a protein occurs in two steps. Transcription: The gene is transcribed by RNA…

Q: Do you think each of the following types of mutationswould have very severe effects, mild effects,…

A: A modification in the sequence of the bases in DNA is referred to as a mutation. The mutation could…

Q: If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid…

A: Mutation is molecular change in the DNA sequence of a gene. Mutations in the coding sequence of a…

Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…

A: Myoclonic epilepsy:It is related to a family of epilepsies which are present along with myoclonus.…

Q: Suppose part of the amino acid sequence of a protein is N... Gly-Ala - Pro-Arg-Lys ...C. Which of…

A: A frameshift mutation occurs when nucleotides are inserted or deleted from the DNA sequence, causing…

Q: Mutated DNA Sequence #3 T A C A C C T TAG C GACGACT... What's the mRNA sequence? (Circle the change)…

A: DNA sequencing is the process of determining the nucleic acid sequence in the order of the…

Q: (a) () The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic…

A: The isoelectric point (pI) is the pH of a solution at which a given protein has a net charge of…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: All of the following pairs are well-match, except one: O Addition of Tubulin dimers occurs more…

A: Microtubules are a part of cytoskeletal elements in eukaryotes. There are two categories of…

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: What is the subject of the figure: What is the main message of the figure? Give a concise, complete…

A: Mutation is alteration in nucleic acid sequence of the gene which causes altered expression or up or…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: 8. Determine the amino acid chain coded for by the following another A is added after the first…

A: Mutations are the changes in the DNA sequence that may lead to harmful results.Frameshift mutations…

Q: N-terminal region variable sequence C-terminal region of

A: Introduction: Cytosolic N terminal region meant it is extended towards the cytosol. The membrane…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: Finish the translation story: - fully explain the G factor stories for each step – and the…

A: Translation Theory: Translation is a biological process that occurs in cells, whereby genetic…

Q: Distinguish between:- a. Glycoproteins and Proteoglycans. b. SIRNA and MIRNA

A: Glycoconjugates are carbohydrates that have been covalently bonded to an amino acid,…

Q: Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells…

A: Deamination is the removal of the aminogroup from a base.  For example; the deamination of the…

Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…

A: Mutation can be divided into several categories. The types of mutation include missense mutation,…

Q: Which of the following would NOT be the right match? O Sickle cell anemia, a point mutation nonsense…

A: Mutations These are defined as the change in the sequence of DNA. These are due to the DNA copying…

Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…

A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…

Q: part 2 H₂N-C N H CH₂ codons CH 3' 12 35 G G anticodon in tRNA 5' Choose one: O A. site 3 OB. site 1…

A: tRNA or transfer RNA has two opposite arms -  one arm is called amino acid arm that contains…

Q: Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 33. Band 3 protein exists as a 95-kDa multipass membrane protein that functions as the primary anion…

A: Given,          Band 3 protein ,a protein which is essential for RBC membrane support and also acts…

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: UjtUJIne (C) Tiucleotides match with guanine Note: RNA contains uracil (U) nucleotides where thymine…

A: There are two types purines and pyramidines. A=T, G=C in the DNA. A: adenine T: thymine G: guanine…

Q: Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency…

A: Since we answer only three subparts of a question at a time, therefore we are answering the first…

Q: Sickle-cell disease is caused by a so-called point mutation in the humanβ-globin gene. A point…

A: Two b-globin polypeptides combine with two a-globin polypeptides (encoded by another gene family)…

Q: Why do you think this substituion is named " NonSense". In your response explain what it means to…

A: Mutation  Mutation is the error in DNA. When a single base or more than one bases are change in the…

Q: 22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous…

A: The interaction between the molecular surfaces occurs due to various reasons. The reasons…

Q: 1 Foundations Cell Molec The first 17 amino acyl residues in human preproinsulin are…

A: Colinearity simply refers to the relationship between the length of a DNA sequence in a gene and the…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Distinguish between:- a. Glycoproteins and Proteoglycans. b. SIRNA and MiRNA

A: Glycoproteins Proteoglycans Glycoproteins are a class of conjugated proteins, with a prosthetic…

Q: HbS results from the substitution of valine forglutamic acid at the number 6 position in the b…

A: HbS is the result of a single base-pair mutation in the gene responsible for the beta-globin chain…