Lecture2_WhyBehavior_23Aug

pdf

School

Indiana University, Bloomington *

*We aren’t endorsed by this school

Course

103

Subject

Psychology

Date

Oct 30, 2023

Type

pdf

Pages

48

Uploaded by AmbassadorAnt2735

Report
Please sit near someone new
Last time • Introductions, note cards • Syllabus overview • Top Hat practice Today’s topics • What is an animal? • What is behavior? • Why study behavior? • Scientific Method • Anthropomorphism
Hi! My name is Amalia. What’s yours? Meet and greet again! (with a different person)
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
What made your previous courses successful (or not) for you? • With your neighbor(s), reflect upon the best and worst classes you have taken in your major/related fields • What actions will you need to take to do well in this course? • What actions would you like to see taken by me?
Other notes • Check your email & Canvas frequently (preferably every week day) • In-class participation will be assessed via Top Hat or worksheet you turn in (see syllabus for details including # you can miss) • More info. on your two assignments to come…
Top Hat question • Why are you taking this class? (i.e., What do you hope to get out of this class (besides a good grade)) ?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
1. Course logistics 2. What is an animal/behavior? 3. Why study behavior? 4. Evolution 5. The scientific method 6. Anthropomorphism Charles Darwin Animal Behavior
In groups of 2-5… • What is an animal? How is it different from non-animals?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
https://vimeo.com/88829079 https://www.youtube.com/watch?v=NuCt0-m3VI8
• Is this an animal?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
• Is this an animal?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
PokéBio at Purdue • Strange things are happening on Purdue University’s campus. Unknown endangered Pokémon have appeared on campus. They seem to hold a special connection to this area of the world. We’ve located where they might be hiding. As trainers, please help us gather data by visiting each of the 12 EcoSpots! https://pokebiopurdue.wixsite.com/pokebio August 14 - September 15
1. Course logistics 2. What is an animal/behavior ? 3. Why study behavior? 4. Evolution 5. The scientific method 6. Anthropomorphism Charles Darwin Animal Behavior
What is behavior?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
What is behavior?
behavior is Any internally coordinated, externally visible pattern of activity that responds to changing external or internal conditions
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
behavior is … the observable actions and activities of individual animals “ The only animal not behaving is a dead animal! ” (Scott 2005) Iannis Rigakis
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
1. Course logistics 2. What is an animal/behavior? 3. Why study behavior? 4. Evolution 5. The scientific method 6. Anthropomorphism Charles Darwin Animal Behavior
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
1. Interface of ecology, physiology, & evolution Why study Animal Behavior?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
history development human behavior social behavior parental care mating antipredator behavior communication feeding animal cognition behavioral endocrinology
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
“A course in animal behavior is where all the other biology and psychology classes that students have sat through up to this point in their academic career come together. Genetics, development, anatomy, physiology, endocrinology, neurobiology, evolution, learning, & social theory congeal into one grand subject – animal behavior.” ~ Lee Dugatkin, 2004
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
1. Interface of ecology, physiology, & evolution 2. Indication of environmental degradation Why study Animal Behavior?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
EPA has used the distribution of sympatric minnows as indicative of pollution & habitat degradation bluntnose tolerant of organic pollution and habitat degradation streamline chub intolerant of organic pollution and habitat degradation
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Tyrone Hayes has studied the effects of atrazine (corn herbicide) on sexual morphology and behavior in amphibians
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Developmental abnormalities with atrazine at 0.1 ppb. EPA standard for drinking water is 3 ppb!
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
1. Interface of ecology, physiology & evolution 2. Indication of environmental degradation 3. Economic value Why study Animal Behavior?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Knowledge of behavior improves profitability in farming, hunting, and ecotourism
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Knowledge of behavior improves profitability in farming - pollination and pest control (pheromone traps)
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
We benefit from animals’ ecosystem services
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Why study Animal Behavior? 1. Interface of ecology, physiology & evolution 2. Indication of environmental degradation 3. Economic value 4. Animal welfare
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Knowledge of a species behavioral ecology can greatly improve its welfare in captivity More realistic/appropriate cleaning protocols have been implemented as knowledge of wild rodent behavior has increased
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Why study Animal Behavior? 1. Interface of ecology, physiology & evolution 2. Indication of environmental degradation 3. Economic value 4. Animal welfare 5. Wildlife conservation
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
What habitat & how much space? How are they impacted by humans? Do they migrate? Behavioral knowledge aids in preservation
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Knowledge of natural breeding behavior can improve captive breeding programs…
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
…and help with reintroductions Bryce Masuda applies behavioral knowledge for Hawaiian crow reintroductions on Maui
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Dung beetles and urbanization “These beacons draw beetles towards the most hostile regions of their environments,” says Foster. “ After rolling their balls some distance, beetles need to find a patch of soft sand where they can dig in. They are unlikely to find that in the immediate vicinity of bright artificial lights , whether in cities or the countryside, since these are usually associated with concrete and tarmac.”
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Why study Animal Behavior? 1. Interface of ecology, physiology & evolution 2. Indication of environmental degradation 3. Economic value 4. Animal welfare 5. Wildlife conservation 6. Understanding of human social behavior
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Evolutionary psychologists have studied the potential evolution of human behavior • Aggression • Paternal care • Child abuse • Monogamy • Alcoholism An attraction to ethanol may have been adaptive in our evolutionary past
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
We can learn from other animals • Scientists research albatross to design more durable drones • Longest wingspan of any living bird species (11.5 feet) • Can glide 10,000 miles without flapping! • Operate very close to the structural limits for wing length and wing loading • Black on top, white underside color effects on flight aerodynamics o Found constant lift to drag ratio, and drag reduction, resulting in better endurance
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Any other reasons we would want to study animal behavior? How do you hear people talking about animals?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Manakins
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Related Documents

Study Guide Topics 100b.pdf
Discussion4.docx
Lecture4_Ethograms_HypothPred.pdf
Lecture8_History2_4Questions_8Sep.pdf
Lecture9_BehavGen_Hormones_11Sep.pdf
Lecture7_Evolution4_History1_6Sep.pdf
Lecture3_SciMethod_Anthropomorphism_25Aug.pdf
When reflecting on learning is the product of.docx
ATI Self Concept Case Study Student.docx
unit 2 Discussion Q3 #2.docx
unit 2 Discussion Q3 #3.docx
Assignment 2 CBT & Depression.docx
Recommended textbooks for you
Text book image
Ciccarelli: Psychology_5 (5th Edition)
Psychology
ISBN:9780134477961
Author:Saundra K. Ciccarelli, J. Noland White
Publisher:PEARSON
Text book image
Cognitive Psychology
Psychology
ISBN:9781337408271
Author:Goldstein, E. Bruce.
Publisher:Cengage Learning,
Text book image
Introduction to Psychology: Gateways to Mind and ...
Psychology
ISBN:9781337565691
Author:Dennis Coon, John O. Mitterer, Tanya S. Martini
Publisher:Cengage Learning
Text book image
Psychology in Your Life (Second Edition)
Psychology
ISBN:9780393265156
Author:Sarah Grison, Michael Gazzaniga
Publisher:W. W. Norton & Company
Text book image
Cognitive Psychology: Connecting Mind, Research a...
Psychology
ISBN:9781285763880
Author:E. Bruce Goldstein
Publisher:Cengage Learning
Text book image
Theories of Personality (MindTap Course List)
Psychology
ISBN:9781305652958
Author:Duane P. Schultz, Sydney Ellen Schultz
Publisher:Cengage Learning
SEE MORE TEXTBOOKS
Recommended textbooks for you
Text book image
Ciccarelli: Psychology_5 (5th Edition)
Psychology
ISBN:9780134477961
Author:Saundra K. Ciccarelli, J. Noland White
Publisher:PEARSON
Text book image
Cognitive Psychology
Psychology
ISBN:9781337408271
Author:Goldstein, E. Bruce.
Publisher:Cengage Learning,
Text book image
Introduction to Psychology: Gateways to Mind and ...
Psychology
ISBN:9781337565691
Author:Dennis Coon, John O. Mitterer, Tanya S. Martini
Publisher:Cengage Learning
Text book image
Psychology in Your Life (Second Edition)
Psychology
ISBN:9780393265156
Author:Sarah Grison, Michael Gazzaniga
Publisher:W. W. Norton & Company
Text book image
Cognitive Psychology: Connecting Mind, Research a...
Psychology
ISBN:9781285763880
Author:E. Bruce Goldstein
Publisher:Cengage Learning
Text book image
Theories of Personality (MindTap Course List)
Psychology
ISBN:9781305652958
Author:Duane P. Schultz, Sydney Ellen Schultz
Publisher:Cengage Learning
SEE MORE TEXTBOOKS

Browse Popular Homework Q&A

Q: 1) Describe the difference between accrual and cash basis accounting.
Q: A 3.0-kg box is held at rest against a vertical wall by a pushing force from my hand. Use g = 10…
Q: An investment has been making money. Its value has been increasing at the rate of 6.4% per year.…
Q: Three small but dense objects are located in the x-y plane as shown in the figure. The objects have…
Q: What is the function of carbonic anhydrase? a. To catalyze the interaction of carbon dioxide with…
Q: The following table shows the distribution of murders by type of weapon for murder cases in a…
Q: 1) You learned that light is an electromagnetic wave that can travel through a vacuum. Can sound…
Q: Set up the definite integral that gives the area of the region. Y₁ = x² + 2x + 5 Y2 = 2x + 30 -5 dx…
Q: solve for first and second derivative (x2 + 8)2(x − 8)
Q: The sales tax on an item is 4%. Express the cost, c, in terms of the price of the item, p. c = |p(c)…
Q: Which of the following sequences would successfully accomplish the shown synthetic ransformation?
Q: a bookstore owner examines 6 books from each lot of 20 to check for missing pages.If he finds at…
Q: A uranium-238 nucleus undergoes a radioactive decay, 238 U 234Th + 4He. The masses are approximately…
Q: Students at Upscale University are required to take at least 3 humanities and 4 science courses. The…
Q: For the function f(x) = -3ex, find f''(x), f''(0), f''(7), and f''(-9). f''(x) = (Type an exact…
Q: You wish to retire in 30 years, so you begin a 401K program that pays $100 into your account weekly…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
Q: The self-schema is best described as the internal monitor of social acceptance versus rejection. the…
Q: Use the theorem given below to find the curvature. r(t) 2ti + 4 sin(t)j + 4 cos(t) k = Theorem: The…
Q: QUESTION 7 9 What is this a symbol of? O Motor starter coil O Heater Horn O Solenoid valve
Q: The rectangular coordinates of a point are given. Plot the point. (-8√2, -8√2) O ... -15 -10 -5 -15…
Q: (e) Compute the mean μx. Round the answer to two decimal places. Mx X S
Q: 4.26 A single-phase load is supplied through a 34.5-kV feeder and a 34.5/2.4-kV transformer. The…
Q: This is with excel. With a pen and paper, what is the equation to solve this problem. The visuals of…
Q: Find the following matrix product, if it exists. 10 [8] -3-6 7 Select the correct choice below and,…