CTQ 8

pdf

School

University of Guelph *

*We aren’t endorsed by this school

Course

309

Subject

Biology

Date

Jan 9, 2024

Type

pdf

Pages

3

Uploaded by BarristerHummingbirdMaster241

Report
1 CRITICAL THINKING QUESTIONS 8 (Total: 13 marks) Due November 24 by 6 pm EST 1. Consider the cDNA (CDS is shown in green; note the start and the stop codon on the sense strand flanked by UTRs in black) to answer the questions below: 5’ TATCTGTACTTAGCGCGG ATGCAGCGGGTACCCTATCTATAG CCCTATGCGTATGCG 3’ Sense strand 3’ ATAGACATGAATCGCGCC TACGTCGCCCATGGGATAGATATC GGGATACGCATACGC 5’ Antisense strand a) You want to generate a gene-specific riboprobe to detect the transcript for this CDS. Will you be using a sense probe or an antisense probe? (1 mark) You will use the antisense probe b) Of the two DNA strands above, which strand will you be using as a template for in vitro transcription for generating the probe you will need to detect the transcript? (1 mark) You would use the sense strand as a template for in vitro transcription. c) The cDNA above is an insert in an expression vector with two promoters on each side of the insert which are able to drive expression of the CDS in opposite directions. The plasmid backbone with the promoters has not been shown. It is known to us that prior to in vitro transcription to generate the riboprobe, linearizing the plasmid is essential to generate a probe that is specific to the target. Using an arrow, show in the sequence below at what position you would like to cut the DNA to linearize the plasmid to generate a gene-specific probe which will be able to detect the transcript. (2 marks) 5’ TATCTGTACTTAGCGCGG ATGCAGCGGGTACCCTATCTATAG ↓ CCCTATGCGTATGCG 3’ Sense strand 3’ ATAGACATGAATCGCGCC TACGTCGCCCATGGGATAGATATC ↑ GGGATACGCATACGC 5’ Antisense strand To generate a gene-specific probe that can detect the transcript, you would want to linearize the plasmid just after the end of the coding sequence (CDS) d) Which strand will serve as a template to generate the probe which will be used as a negative control in this experiment? (1 mark)
2 The antisense strand will serve as the template to generate the probe. This probe will then be complementary to the mRNA transcribed from the sense strand, and it will be a negative control in the experiment. This is because it will not bind to the mRNA, as the mRNA is also complementary to the antisense strand. If the probe does bind in your experiment, it would suggest that there is some non-specific binding occurring. 2. Why is using a radiolabeled probe advantageous than using a DIG-labeled probe during Southern Blotting although working with radioactive substances and radiation is unsafe? (2 marks) Radiolabeled probes have been used in Southern blotting due to their high sensitivity and resolution. Radiolabled are very sensitive and can detect very small amounts of DNA or RNA sequences, this is good when the target is present in low amounts. The resolution is also very high with radiolabeled probes giving clear bands, this is useful when you wanna distinguish between sequences that are similar. 3. Why is a Klenow fragment used while generating primers by random priming? (2 marks) The klenow fragment is used while generating primers by random priming because, it makes less errors when synthesizing DNA, which is important for accuracy of primers. Also, it does not have a 5’ to 3’ exonu clease activity, this prevents the newly made DNA strand from being degraded as soon as it is made. 4. Which enzyme can you use to radioactively label ends of a dsDNA without a synthesis step? What do you need to use as a substrate for the enzyme? (2 marks) The enzyme you can use to radioactively label ends of dsDNA without a synthesis step is polynucleotide kinase (PNK). The substrate you need to use for this enzyme is is gamma-labeled ATP, the gamma phosphate of ATP is the one that is transferred to the DNA, using P32 or P33, the DNA will then be radioactively labeled. 5. How can we avoid false negative results in a Southern Blot? (2 marks) You can avoid a false negative result in a southern blot by using a positive control, you can do this by improving the specificity, by raising the temperature of hybridization or lowering the salt content. This would ensure that the sample would bind to the DNA probe only if it has a 100% match ensuring you can’t get a false negative since you are only getting the result you desire. Another way to avoid false negative result is to ensure you don’t have a tissue sample error.
3
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Related Documents

Anatomy Lab Homework 2 (1).docx
Individual Assignment_1.docx
Worksheet Week 7.pdf
CTQ 3.pdf
Worksheet Questions 5.pdf
Worksheet Questions 4.pdf
CTQ 9.pdf
Week 5 lab ap 255.pdf
Derak-Photosynthesis Lab Report Rough Draft.pdf
chap 10 Expect_The_Unexpected_A_First_Course_In_Biostatist..._----_(Statistics) (3).pdf
BIO250 Lab 4.docx
BIO250 Lab 7.docx
Recommended textbooks for you
Text book image
Principles Of Pharmacology Med Assist
Biology
ISBN:9781337512442
Author:RICE
Publisher:Cengage
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
SEE MORE TEXTBOOKS
Recommended textbooks for you
Text book image
Principles Of Pharmacology Med Assist
Biology
ISBN:9781337512442
Author:RICE
Publisher:Cengage
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
SEE MORE TEXTBOOKS