Worksheet Week 7

Worksheet Week 7 Submit this worksheet to the Dropbox by Oct 20 at 11:00 AM 1. Indicate the amount of each of the components needed to make a 40 ml 0.5% (w/v) agarose gel. Amount needed (include units) 5X Tris-acetate buffer 8 mL Agarose 0.0125 mL dH 2 0 31.9875 mL 2. You have isolated genomic DNA in a 50  l final volume. You add 5  l of the DNA solution to 1 ml final volume and measure the OD 260 of the to be 0.01. How much DNA is in the cuvette and how much do you have in total? 5 ul -> 0.005 ml DF = 0.005 + 1 /0.005 50 x 0.01 x 201 100.5 3. Indicate with an “yes” or “no” whether the technique is able to provide the indicated information. Electrophoresis Spectroscopy Distinguish supercoil versus linear plasmid DNA Yes No Estimate protein contamination Yes Yes Estimate the number of fragments of DNA in a plasmid digest No Yes Determine whether your DNA sample has degraded Yes Yes Quantification of the amount of DNA present in a sample No Yes How does a nanodrop spectrophotometer differ from a conventional spectrophotometer? NanoDrop is able to scan samples through the 220-750nm range while other spectrophotometer do not. Less prep and clean up time. They use small samples 2 ul drops and can measure several samples in a minute.

4. Review the sequences that can be obtained from each type of library using this chart by placing an X in the column if the library contains the indicated element. To help you, consider whether the source could be used as a template for a PCR to recover the indicated element. Genomic library cDNA library Genetic element Yes Yes Exons Yes Yes 5’ UTR Yes Yes ORF (open reading frame) Yes No Introns Yes Yes A collection of all sequences in an organism (ideally) Yes No Centromeric repeat sequences Yes No Promoter elements No Yes Coding sequences Yes No Intergenic sequences Yes Yes 3’ UTR Yes No A collection of all transcribed sequences in a specific group of cells of an organism 5. This is a challenging question that requires you to think about several past concepts. You should watch the short video I made before starting this question. You want to add two different restriction sites to the 5’ and 3’ ends of the sequence below. (5’ end: Bam HI 3’ end: Xba I) a) Design the two 8 nucleotide primers needed to add these sites to the fragment below by PCR. You will have to look up the recognition site for each enzyme and recall the issues mentioned in the video for adding these sites to primers. Use X’s for any non - specific additional nucleotides that are needed. 5’ ATGAGAGTCTCGCCTATGCTCGACGCTGACTGCTCGATC GTCG 3’ TACTCTCAGAGCGGATACGAGCTGCGACTGACGAGCTAGCAGC BamHI GGATCC Xbal TCTAGA Forward Primer (written 5’ to 3’): 5’ XXXXXX GGATCC ATG AGAGTCTCGCCTATGCTCGACGCTGACTGCTCG 3’ Need lead sequence(6-10) Restriction enzyme ATG start (forward) GoI sequence