BIO257_PS1.2023

txt

School

University of Rochester *

*We aren’t endorsed by this school

Course

257W

Subject

Biology

Date

Jan 9, 2024

Type

txt

Pages

Uploaded by MagistrateViper3914

Problem Set 1 BIO 257 Due 9/12/23 You may discuss this problem set with your classmates but the work must be done independently. Please follow all instructions carefully. Total points: 10 1) Copy the PS1 folder to your class user directory '/scratch/bio257_2023/Users/user_id' directory. (Note: replace 'user_id' with your user id) Change the name of new PS1 folder in your directory to 'user_id.PS1'. Do all of the following problems inside that directory. Please paste all commands that you used to answer the questions below in this text file. cd /scratch/bio257_2023/Users/xlu36 cp /scratch/bio257_2023/Problem_Sets/PS1/seq.txt . cp /scratch/bio257_2023/Problem_Sets/PS1/sample.fasta . cp /scratch/bio257_2023/Problem_Sets/PS1/BIO257_PS1.2023.txt . mkdir xlu36.PS1 mv sample.fasta seq.txt BIO257_PS1.2023.txt xlu36.PS1 2) Change permissions on your 'user_id.PS1' folder itself (*not recursively*) so that owner (you) can read, write, and execute, but all others cannot read, write, or execute. cd xlu36.PS1 chmod 700 .. ls -l .. Output: drwxr-s---+ 2 xlu36 bio257_2023 4096 Sep 5 12:54 Module1 -rw-r--r--+ 1 xlu36 bio257_2023 92 Sep 5 13:09 xlu36.info.txt drwx--S---+ 2 xlu36 bio257_2023 4096 Sep 7 13:15 xlu36.PS1 3) Use grep to find the line matching "NNNNNNNNN" in the file 'seq.txt' and pipe to 'more'. grep "NNNNNNNNN" seq.txt|more Output: TTCCTTTCCCTAAATCCTTAAAAAGGTAATAGTANNNNNNNNNGC 4) Print the first 4 lines of the 'sample.fasta' file using 'head' and the last 2 lines using 'tail'. Output both to 'out.txt' (hint: remember not to overwrite!) head -4 sample.fasta>out.txt tail -2 sample.fasta>>out.txt more out.txt Output: >Seq1 GAATGTCAAATTCAGATTTATGGCCTAGCCTATGAGAGTTACAAACAATGAGAGTCGATTACATATGAATTT ACACCTATTTCTAGTTCTACGTATGCATATCGATTCAATTCATCCATTCATTCCGTTGTATTGTCGAGTATA AAACGTACATTTGACTAATCATATAGAGATATTGTCAGACAATTGTTGCTAGATATTGCTT >Seq2 ACGATGAACTACAAAAGCGTTCTCGCCTGTTTTATACGTTTAAAGCTTAGACTACGTACAAAAGGTTTGGGT

TAGTAATATAAAGCTATATTCAATGCTAAAGTCTTAGGTAGCGCTTAAGTGTACGGATGAGTTACTCTTAAG TACAGATCAAATCTATGCGAAGGAGAATTACGTATTTACAATACAATTGTCGGAGACTC >Seq5 GTGTACTCAACTATGTACTAAAGCTGCTCCGTTTGTTGCCCTGCAAGGAGGTATTCCATTCGGACTACGATG TCAAGAACTGTCGATTTGCTCTTCGCGAGGCTCTCAAGCAACCAACGT 5) Use grep to count the number of times the sequence "AAAGCT" appears in sample.fasta. grep -o "AAAGCT" sample.fasta Output: AAAGCT AAAGCT AAAGCT AAAGCT AAAGCT AAAGCT AAAGCT 7times 6) Use grep to count the number of lines containing the sequence "AAAGCT" in sample.fasta. grep -c "AAAGCT" sample.fasta Output: 4 7) Create and submit a SLURM script that outputs your present working directory. Make your SLURM script have the following parameters: standard node 15 minutes 1 task 1 GB RAM 8) Make a tarfile of your directory and *move* (not copy) this tarfile to the following directory: /scratch/bio257_2023/Assignment_dump/PS1. I have worked with the following students on this assignment: ___________________________________________________________________________________ ___________________________________________________________________________________ ______________

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

BIO257_PS1.2023

Related Documents