BIOL+200+-+2024+Winter+-+Practice+Questions+-+Exam+1

pdf

School

University of Washington *

*We aren’t endorsed by this school

Course

200

Subject

Biology

Date

Feb 20, 2024

Type

pdf

Pages

Uploaded by MajorWrenPerson979

1 B IOLOGY 200 E XAM I-P RACTICE Q UESTIONS Codon Table → STOP STOP STOP

2 1. Your study partner encourages you to demonstrate your understanding of the following core concepts of biology. Explain how complementary base pairing between DNA and RNA during transcription illustrates each of the core concepts. Limit: 2 sentences per response. A. Information flow, exchange, and storage: What are the inputs and the outputs? B. Structure and function: How does nucleotide structure mediate complementary base pairing and thus information flow? 2. Understanding the directionality of molecules (e.g., DNA, RNA) is important for understanding processes (e.g., transcription, translation, replication). Imagine: Your research leads you to examine the following sequence from a bacterial chromosome. You note the presence of the +1 site, -10 box, and -35 box, as indicated. 3’ -GAC AACTGT TAATTAGTAGCTTGATC ATATTA TCATGC G CTCCAGGT- 5’ 5’ -CTG TTGACA ATTAATCATCGAACTAG TATAAT AGTACG C GAGGTCCA- 3’ [-35 ] [-10 ] +1 A. For this gene, does the top strand or the bottom strand serve as the template for transcription? Mark with an X: Top strand _____ or Bottom strand _____ B. What are the first six nucleotides of the RNA molecule that would be produced by transcription of this gene? For full credit, label 3’ and 5’ ends. Limit: 1 sequence. C. Your research team makes a series of mutations that add or delete nucleotides between the -35 box and the -10 box. Then, they examine the frequency of transcription with each of the mutations. The graph shows frequency of transcription (y-axis) and spacing, in terms of nucleotides, between the -35 box and the -10 box (x-axis). Note: In the original (i.e., wild type) sequence, 17 nucleotides separate the -35 box and the -10 box. Using your understanding of the core concept of structure and function and your understanding of transcription, explain these results. For full credit, address affinity, sigma, RNA polymerase, and frequency of transcription. Limit: 3 sentences.

3 3. Can a hydrogen bond occur at locations 1, 2, and/or 3? Mark “no” or “yes” with an X. If your response is “no,” explain why not. For full credit, address bonds, charges, and spatial arrangements. Hint: Use your understanding of the chemistry of life rather than memorization. Limit: 2 sentences per response. Location 1: No _____ Yes _____ If no, explain why not: Location 2: No _____ Yes _____ If no, explain why not: Location 3: No _____ Yes _____ If no, explain why not: 4. You are a medical scientist studying the following metabolic pathway that allows cells to convert molecule A step-by-step into molecule F. Molecule F is required for life. The unsupplemented growth media does not include molecule A, B, C, D, E, or F. A. A mutation causes the complete loss of enzyme 3 activity. You supplement the growth media with large amounts of the specified molecule. Based on the provided information, predict the phenotype of the mutant cells in each of the specified environments. Mark “die” or “live” with an X. Molecule A Molecule B Molecule C Molecule D Molecule E Molecule F Phenotype Die _____ Live _____ Die _____ Live _____ Die _____ Live _____ Die _____ Live _____ Die _____ Live _____ Die _____ Live _____ B. When you perform the experiment to test your predictions, you accidentally supplement the growth media with large amounts of both molecule A and molecule F. In this environment, you are surprised to observe that the cells die. Propose a hypothesis to explain this observation. Limit: 2 sentences.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

4 5. To practice your analytical and communication skills, you and your study partner are explaining figures to each other. For this study session, your study group emphasizes nucleic acid polymerization. Hint: Number carbons on sugars. Figure A Figure B A. Based on the provided structures, does this figure illustrate the polymerization of DNA (i.e., DNA replication) or RNA (i.e., transcription)? Mark with an X: DNA _____ or RNA _____ B. Based on the provided structures, does this figure illustrate the polymerization of DNA (i.e., DNA replication) or RNA (i.e., transcription)? Mark with an X: DNA _____ or RNA _____ C. Your study partner asks you to label the top and the bottom of the nucleic acid chain in Figure A. Mark with an X. i. Top: 1’ _____, 2’ _____, 3’ _____, 4’ _____, or 5’ _____ ii. Bottom: 1’ _____, 2’ _____, 3’ _____, 4’ _____, or 5’ _____ D. Your study partner states, “In Figure A, the reaction is endergonic (i.e., energetically unfavorable). In Figure B, a second reaction is coupled with nucleic acid polymerization to make the overall reaction exergonic (i.e., energetically favorable).” Then, your study partner asks, "What is this second (uncoupled) reaction that powers the overall reaction?” Limit: 1 reaction.

5 6. To explore relationships among information flow, exchange, and storage; structure and function; central dogma of molecular biology; and human health, you search the scientific literature for associations between mutations and human diseases. You identify a research paper that includes the following sentences in its summary: “Cystic fibrosis (CF) is a common recessive lethal genetic disorder.” “We have now characterized a CF family … and identified a two - nucleotide insertion in the CF allele.” A. First, use the genetic code figure (on the front page of the exam) to translate the following portion of the non-CF allele of the gene. mRNA: 5’ - AUG … AUAUAUAUUCAA … - 3’ protein: Met … Ile _________________________________________ B. Reading the research paper, you find that the two-nucleotide insertion (underlined) changes the sequence, as follows. mRNA: 5’ - AUG … AUAUAU AU AUUC … - 3’ protein: Met … Ile _________________________________________ C. Given this mutation, what consequences would you predict for the remainder of the protein’s amino - acid sequence? Be specific, and explain your reasoning. Limit: 2 sentences. 7. You identify a new enzyme that catalyzes a key step in your favorite biological process. It consists of a single polypeptide chain. You purify large amounts of the enzyme and characterize it in the laboratory. A. Knowing little about the enzyme, you vary the environmental pH and test the activity of the enzyme. i. Which of the following levels of structure could be affected by pH? Mark all correct answers with an X. Primary _____, Secondary _____, Tertiary _____, and/or Quaternary _____ ii. Based on your understanding of the chemistry of life and the structure and function of amino acids and proteins, how could pH affect these levels of structure? Limit: 2 sentences. B. You identify a small molecule that has no similarity to the substrates of the enzyme. Yet, this molecule is able to inhibit the activity of the enzyme. Would you expect this small molecule to be an allosteric activator, an allosteric inhibitor, or a competitive inhibitor? Why? Explain your reasoning. Limit: 2 sentences.

6 8. You are studying a protein that consists of a single polypeptide. You discover a mutant form of the protein in which the leucine amino acid at the amino terminus of the protein has been replaced by a phenylalanine. Which of the following level(s) of protein structure could be affected by this change? (Circle the best answer) 1) primary only 2) primary and secondary 3) primary, secondary and tertiary 4) primary, secondary, tertiary and quaternary 9. Below is the chemical structure of methane. What type of bonds are present in methane (ionic, nonpolar covalent, polar covalent and/or hydrogen)? (List all that apply) Would you expect the hydrogens in methane to form hydrogen bonds with the oxygen atom in a water molecule? Why or why not? (~1 sentence) 10. Of the following four 15-bp double-stranded DNA sequences, which will be most stable at higher temperatures? In other words, which will most likely remain in a double-stranded form? (Note: only one strand is shown here) Choose the single best answer. 1. CATCCTAGCGACTAT 2. CTATACGACATAGCC 3. AAATGCATACATCTT Answer: ______ 4. CCCGCATCGCCATCG B Methane

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

7 11. A. Which of the amino-acids shown on the right would you expect to find on the surface of a cytoplasmic protein? Amino-acid: Is this side chain nonpolar, polar, acidic or basic? (Give the most specific correct answer): B. You are studying a protein which consists of a single polypeptide. You discover a mutant form of the protein in which the leucine amino acid at the amino terminus of the protein has been replaced by a phenylalanine. Explain what effect you predict this change will have on the protein. (1 or 2 sentences). 12. Where in a eukaryotic cell do you expect to find the enzyme RNA polymerase? (1 word) ___________ _______ 13. Below is the sequence of a complete mRNA from a bacterial cell: 5’ ACUAGCAGGAGACGUAAGCG AUGUG C CAGAG GCGCAGUCACACAUAACUGCAAG 3’ A. How many amino acids long is the protein encoded by this mRNA? Answer: ___ B. How many tRNAs will bind to the ribosome to make this protein? Answer: ____ C. What is the second amino acid in the protein (counting from N-terminus to C-terminus): Answer: ____ D. If the bolded C in the sequence was changed to a U, what effect would that have on the primary amino acid sequence of the protein made from this mRNA? Explain your reasoning. 14. Prokaryotes use a different initiating amino acid (f-met) than is found in eukaryotes. The antibiotic drug streptomycin interferes with prokaryotic translation initiation but not eukaryotic translation initiation. A. List one specific target this drug could be blocking in prokaryotes. The target could be a molecule or a specific part of a molecule. B. Explain why this antibiotic would be expected to only block prokaryotic but not eukaryotic translation.

8 15. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. +1 -10 -35 ... 3' TTGCATCCGAAACGCACAATCGATCGGCCGACTTATTACGATCGGACTACTGCGTCGTAGC 5' ... ... 5' AACGTAGGCTTTGCGTGTTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG 3' ... a. Write below the letters for the bases of the first 6 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5’ and 3’ ends of the strand. You find a mutant with a 2-bp insertion of “CG” between the start site of transcription (+1) and the start codon (not shown in the figure) . b. (Choose the best answer) This mutation will change: 1. The sequence of the mRNA 2. The sequence of the protein 3. Both the sequences of the mRNA and the protein Answer: ___ 4. Neither sequence will be changed c. Explain your reasoning for part b in 2 sentences or less. 16. Name one step in the processing of DNA to protein that can be regulated only in a eukaryote. (< 1 sentence) 17. Consider the interaction between sigma and RNA polymerase at the start of transcription in bacteria, and answer both questions below. a. Phages are viruses that parasitize bacteria —they take over a bacterial cell’s machinery and use it to copy viral genes and produce viral proteins, resulting in a new generation of viruses. Many phages have genes for a protein that binds to sigma, displacing it from RNA polymerase. Why did these viral proteins evolve? (Note: the viruses have genes coding for their own RNA polymerase.) b. When environmental conditions are poor, bacterial cells can enter a “stationary phrase” in which they stop dividing and growing — they essentially become dormant. As they enter stationary phase, the cells produce “anti - sigma” proteins that inhibit sigma. What is the adaptive significance of these anti-sigma proteins?

9 18. For each different mutant cell described below, assume that ONE specific molecule or part of a molecule is mutated in that cell so that the molecule’s function has changed. Name as many molecules that could result in the description (but remember that for the mutant phenotype, you are considering each mutation by itself). Cell 1: In many different types of proteins, there is the amino acid Thr (threonine) where an Ala (alanine) should be. ________________________ Cell 2: Many different types of proteins are much shorter than in a normal cell, but have the correct sequence up to that point. tRNA levels are normal in the cell. ________________________ Cell 3: About a third of all new proteins in a mutated cell are not doing their jobs correctly. When you compared to proteins in a healthy cell, these proteins appear much larger overall. 19. You are studying a plant that grows in the forest and has red flowers. You learn that flower color in this plant is determined by a single gene that codes for red pigment. You discover a different species of this plant in a nearby meadow that has white flowers instead of red. You discover that this meadow species contains a “white allele” with a single nucleotide difference upstream of the start site of transcription of the red pigment gene, as shown in Fig. 1. a) Propose a hypothesis for how this nucleotide change could result in white flowers at the molecular level. In your hypothesis, propose specific molecular interactions and cellular processes that would be impacted by the nucleotide change (2 or 3 sentences max). Fig. 1. Red Pigment Gene. The single nucleotide difference found in the white allele is indicated by an asterisk (*). The start site of transcription is indicated by a +1. Transcription proceeds in the direction of the arrow. ! " #$" %$&&" #$&&&"

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

10 b) Interestingly you find that the forest species is pollinated by hummingbirds whereas the meadow species is pollinated only by bees. What could explain the continued presence of the white allele in the meadow plant population through several generations? 20. (18 pts) Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. -35 -10 +1 ... 3' TTGCATCCGAAACGTACGATCGATCGGCCGACGGTATACGATCGGACCGTTACGTCGTAGC 5' ...5’ ... 5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGCCATATGCTAGCCTGCGAATGCAGCATCG 3' ...3’ a. Write below the letters for the bases of the first 6 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5’ and 3’ ends of the strand. b. The ribosome binding site for this gene is not shown on the sequence above. Where would you expect to find the ribosome binding site for this gene? Refer to all relevant sequences that would act as landmarks and use the words upstream and downstream in your description. c. This gene is normally expressed at low levels. You find a mutant form of this gene that is expressed at much higher levels. Explain how a mutation in the promoter region could result in increased transcription.

11 21. You have done a genetic screen looking for mutants in the Compound D synthesis pathway (shown below). Compound D is essential for life. Fill in the table with the expected phenotype (LIVE or DIE) for cells carrying mutations in each of the listed enzymes.

12 Q22. (16 pts) You have performed a genetic screen and found several mutants that survive in media supplemented with Lysine, but these same mutants die when transferred to media with no supplements added. The metabolic pathway for Lysine is known and is shown below. You grow your mutants on the precursors for Lysine and get these phenotypes Given these results, which enzyme is defective in each mutant? Circle the correct answer for each mutant. Note that each of the mutants has a defect in a different enzyme. Mutant X has a defect in: Enzyme 1 Enzyme 2 Enzyme 3 Mutant Y has a defect in: Enzyme 1 Enzyme 2 Enzyme 3 Mutant Z has a defect in: Enzyme 1 Enzyme 2 Enzyme 3 What would be the phenotype of a double mutant in Enzyme 1 and Enzyme 3 grown in media supplemented with Saccharopine Media is supplemented with: Mutant X Mutant Y Mutant Z Isocitrate DIE DIE DIE Aminoadipate DIE DIE LIVE Saccharopine LIVE DIE LIVE

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

13 23. List 2 different effects that increased temperature can have on a reaction: 24. (10 pts) The diagram below shows transcription and translation occurring on a piece of DNA in a bacteria cell. The DNA is indicated. a. The arrow in the diagram is pointing to which of the following? (Circle one) A. Amino terminus of a new protein B. Carboxy terminus of a new protein C. 5’ end of a mRNA D. 3’ end of a mRNA b. Using what you know about the processes of transcription and translation, explain why you would not expect to see this arrangement of molecules in a human cell (2 sentences maximum). 25. (12 pts). You are studying two mouse proteins: PURPLE and RED that are made in all mouse cells. When you look in the mouse cells you find that the PURPLE and RED proteins usually interact with each other. You mutate a single base pair in the gene that codes for the PURPLE protein and observe that although the PURPLE protein is still made in the mouse cells, it no longer interacts with the RED protein. Using your understanding of information flow, explain how this difference in the DNA in the PURPLE gene could affect each step in the central dogma to result in this loss of interaction. (2-3 Sentences)

14 26. (12 pts) Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. a. Transcribe the sequence shown in the box above. In the space below, write the first 6 nucleotides of the mRNA including 5’ and 3’ polarity. ___________________________ b. Name the enzyme that is required for this process to occur ________________________ c. If you inserted a single base pair after the start codon of this gene (not shown in the sequence above), which of the following would be affected? Circle all that apply. mRNA sequence Primary amino acid sequence Reading frame Transcription start site 27. (14 pts) Match descriptions listed in the table to the appropriate protein(s) or molecule(s) from the list on the right (A-H). Write ALL correct answers. There is at least one answer for each description and there may be more than one answer for some. Not all the choices will necessarily be used. Protein or molecule Name A. Sigma B. Amino acyl tRNA synthetase C. Alanine tRNA D. Small ribosomal subunit E. RNA polymerase Description Answer(s) i. Can bind to a specific DNA sequence? ii. Can bind to a specific RNA sequence? iii. Can be found in a prokaryote iv. Contains many peptide bonds v. Can be found in the cytoplasm of a eukaryote 3 ’...GGACCTGGACCTGGCTGCCATCGCATATCGATCACAGCGATGGTGGCAATGCGTCGACTG...5’ 5 ’...CCTGGACCTGGACCGACGGTAGCGTATAGCTAGTGTCGCTACCACCGTTACGCAGCTGAC...3’ +1 -10 -35

15 28. (20 pts) You have performed a genetic screen and found several mutants that survive in media supplemented with the amino acid Lysine, but these same mutants die when transferred to media with no supplements added. The metabolic pathway for Lysine is shown below. You grow your mutants in different media and get these phenotypes: a. Given these results, which single enzyme is most likely to be defective in each mutant? Circle the correct answer for each mutant. Note that each of the mutants has a defect in a different enzyme. Mutant X has a defect in: Enzyme 1 Enzyme 2 Enzyme 3 Mutant Y has a defect in: Enzyme 1 Enzyme 2 Enzyme 3 Mutant Z has a defect in: Enzyme 1 Enzyme 2 Enzyme 3 b. State the phenotype of a double mutant in Enzyme 2 and Enzyme 3 grown in media supplemented with Saccharopine (One word) c. You find another mutant called Mutant A that has the identical phenotype as Mutant X (shown in the chart above). You discover that: 1) Mutant A has a different mutation than Mutant X 2) Both Mutant A and Mutant X are missing the function of the same enzyme In terms of the central dogma, explain how it is possible for Mutant A and Mutant X to have different genotypes but the same exact phenotype. Use molecular terms to explain your answer (2-3 sentences). Media is supplemented with: Mutant X Mutant Y Mutant Z Isocitrate DIE DIE DIE Aminoadipate LIVE DIE DIE Saccharopine LIVE DIE LIVE

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

16 29. (16 pts) We are testing electron affinity, and we create an experiment where an electron has been placed equal distance between two atoms (on the dotted line). For each box below, do the following: a. Draw an * to show where the electron is most likely to be after some time has passed. b. Circle POLAR or NONPOLAR above each box to indicate the most likely type of covalent bond to form between these atoms. c. Describe one of the functional groups that is part of the structure of a nucleotide or an amino acid that is essential for its function. Make sure you explain why this functional group is required for full function of the nucleotide or amino acid (2-3 sentences). 30. (12 pts) The graph below shows the energy profile for the chemical reaction A + BC AB +C. a. Explain how addition of an enzyme increases the rate of a reaction (1 sentence). b. How could you increase the rate of this reaction without adding an enzyme? (1 sentence or less). Free Energy Progress of reaction No enzyme Plus enzyme

17 31. (20 pts). You are studying the effects of pH on the enzyme lactase which cleaves the substrate ONPG resulting in a yellow color. You mix lactase and ONPG together in a solution at pH1 and allow the reaction to proceed for 1 hour before measuring the amount of yellow produced. You repeat this experiment at pH 3, 5, 7, 9 and 11 and get the results shown in the graph on the right. a. What could you conclude about the activity of lactase from this result? Assume that all experimental controls gave expected results (1 sentence) b. Which level(s) of protein structure is likely impacted at pH 1? Select all that apply: Primary Secondary Tertiary c. Based on what you know about protein structure and enzyme activity, explain the result seen at pH 1 (1-2 sentences). d. Another lab group repeats the experiment and sees the results shown in the graph at the right. They checked to make sure that they added all of the reagents in the right amount to the assay. No additional reagents were added. What could have happened to lead to these results? pH Amount of yellow 1 3 5 7 9 11 low high pH Amount of yellow 1 3 5 7 9 11 low high

18 32. (6 pts). You find a cell containing a mutant form of glycine tRNA which has an altered anticodon that binds to the codon GAG instead of GGG. SEE GENETIC CODE ON FIRST PAGE Briefly describe the effect this mutation will have on proteins made in the cell (1 sentence or less): Explain your reasoning (2-3 sentences): 33. In the box below, draw 2 different dotted lines to illustrate where 2 different hydrogen bonds could form between a water molecule and the tripeptide shown. Explain your reasoning.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

19 34. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. A. Transcribe the sequence shown in the box above. Write the first 6 nucleotides of the mRNA including 5’ and 3’ polarity: B. The - 10 region of the promoter frequently contains a sequence rich in A’s and T’s. Based on what you know about nucleotides and the process of transcription in bacteria, what would be an evolutionary advantage in having this sequence just upstream of the start site of transcription? (1-2 sentences) C. You inserted 1 base pair AFTER the ribosome binding site but BEFORE the start codon of this gene (not shown in the sequence above). This change did not create a new start codon. Please complete the following table. Would you expect this item to be affected (yes or no)? a. mRNA sequence b. Primary amino acid sequence c. Reading frame d. Transcription start site 35. You are studying an enzyme called Proteinase K which is composed of a single subunit and catalyzes the cleavage (breaking) of peptide bonds. A. You discover an inhibitor that blocks Proteinase K activity. The inhibitor binds directly to Proteinase K, but not to its active site. What type of inhibitor is this? (1-2 words) B. You add Proteinase K to a test tube containing a protein substrate. How could you change the environment of the reaction to inhibit the activity of Proteinase K without adding an inhibitor molecule? (3-4 words) C. Which of the following would be disrupted using the approach you described in B above? Please select the best answer : a. Primary amino acid structure only b. Primary and Secondary amino acid structure c. Primary, Secondary and Tertiary amino acid structure d. Primary, Secondary, Tertiary and Quaternary amino acid structure e. None of the above 36. In the figure, a cyclic AMP molecule is bound by a protein. 5’...CCATCGCGACTGCAGTTCGCCATGTATAGGCATGGCACGATCGATGACCGATAACGATCG...3’ 3’...GGTAGCGCTGACGTCAAGCGGTACATATCCGTACCGTGCTAGCTACTGGCTATTGCTAGC...5’ +1 -10 -35

20 A. Based on the figure, complete the table below. Type of Interaction Does the indicated type of interaction contribute to the molecular affinity between the cyclic AMP molecule and the protein (yes or no)? Covalent bond Hydrogen bond Ionic bond Hydrophobic clustering B. Is cyclic AMP hydrophilic or hydrophobic? (1 word) C. Briefly explain your answer for Q3B. (1 sentence) D. Imagine that cyclic AMP were not available for binding. What molecule could bind in its place?

21 37. (16 pts) Match descriptions listed in the table with the letters for the appropriate names from the list on the right (A- E). Write ALL correct answers . There is at least one answer for each description and there may be more than one answer for some . Not all the choices will necessarily be used. 38 . You are studying a pathway that leads to production of a toxic compound “D” in the bacteria E. coli which results in cell death. The pathway for production of D is shown below. You perform a genetic screen and identify 3 mutant E. coli strains (X, Y and Z) that each survive when grown in media supplemented with Compound A. Table 1 A . Given the results shown in Table 1, which single enzyme is most likely to be defective in each mutant? Each of the mutants has a defect in a different enzyme . Mutant X has a defect in (enzyme 1, 2 or 3): Mutant Y has a defect in (enzyme 1, 2 or 3): Mutant Z has a defect in (enzyme 1, 2 or 3): B. State the phenotype (LIVE or DIE) of a double mutant in Enzyme 1 and Enzyme 2 grown in media supplemented with compound B: C. Briefly explain your answer for Part B (1 sentence). Media contains Mutant X Mutant Y Mutant Z A LIVE LIVE LIVE B LIVE LIVE DIE C DIE LIVE DIE D DIE DIE DIE Enzyme 1 Enzyme 2 Enzyme 3 A B C D Description Answer(s) Names A. ATP B. Gene that codes for a ribosomal protein C. Methionine tRNA D. cAMP dependent Protein Kinase A (PKA) E. Small subunit of ribosome i. Can lower the activation energy of a reaction ii. Can bind to a specific RNA sequence iii. Has molecular affinity for Sigma iv. Can be found in the cytoplasm of a eukaryote

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

22 39. You compare the amino acid sequences of ten different kinases. You discover that there are several amino acids that are conserved (identical) in all of the kinases. Based on your specific knowledge of kinases and enzyme s, what is one likely function of these conserved amino acids? Be as specific as possible (1-2 sentences) 40. Stop codons are not recognized by complementary tRNAs. Instead, stop codons are recognized by release factors. What are two distinct structural features of release factors that support their functions? A. Structural feature #1 (1 sentence): B. Structural feature #2 (1 sentence): 41. Imagine: You are a researcher studying tRNAs and translation. A. What process(es) does a cell use to produce tRNAs (1-2 words)? B. In your research, you identify a mutation that changes the anticodon sequence of a specific tRNA from 5’ -CCA- 3’ to 5’ -UCA- 3’. No other parts of the tRNA are changed. Complete the Table below . Anticodon Write the codon that is recognized by the indicated anticodon. Be sure to label 5’ and 3’ ends. 5’ -CCA- 3’ 5’ -UCA-3 C. For a cell with the mutation described in B, what consequences for translation would you predict? For full credit, address how this mutation would or would not change protein sequences (1-2 sentences). Refer to the codon table provided on p.1. Hint: You may find it useful to work this problem on scratch paper first. 42. Below is a portion of a bacterial chromosome that contains a gene. The conserved -35 and -10 boxes in the promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. A. You discover an altered form of this gene that contains 3 base pair substitutions in the nucleotides marked by the asterisks. Based on what you know about transcription, what impact do you predict these changes would likely have on transcription? Select a single correct answer: __ a. Likely to result in a decreased rate of transcription initiation and no change in the rate of transcription elongation b. Likely to result in a decreased rate of transcription initiation and a decreased rate of transcription elongation c. Likely to result in no change in the rate of transcription initiation and a decreased rate of transcription elongation d. Likely to result in no change in the rate of transcription initiation and no change in the rate of transcription elongation

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

23 B. Explain your reasoning to Q1A. (1-2 sentences) C. RNA polymerase catalyzes the polymerization of ribonucleotides. Using your understanding of energetics, explain why RNA polymerase likely evolved to use ribonucleotide triphosphates (e.g. cytidine triphosphate) but not ribonucleotide monophosphates (e.g. cytidine monophosphate) as the substrates in this reaction. (1-2 sentences) 43. (11 pts) The figure below shows three amino acids linked together to form a tripeptide. The arrows are pointing to hydrogen (H) or oxygen (O) atoms in this peptide. Fig 1 A. (9 pts) Based on Fig 1 and your understanding of the relative electronegativities of C, H, N and O atoms, complete the table below. Property of indicated atom List ALL of the appropriate labeled atoms (1,2, 3, 4 and/or 5) Located closest to the carboxy terminus of the peptide Likely to carry a partial negative charge Likely to carry a partial positive charge Potential location for a hydrogen bond to form B. (2 pts) How would you classify the amino acid located at the amino terminus of the tripeptide (acidic, basic, polar or nonpolar)? (1 word) __ _______ __

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

24 44. (12 pts) Match descriptions listed in the table with the letters for the appropriate names from the list on the right (A- F). Write ALL correct answers . There is at least one answer for each description and there may be more than one answer for some . Not all the choices will necessarily be used. Description Answer(s) Names A. Alanine tRNA B. Sigma C. Gene that codes for cAMP dependent Protein Kinase A (PKA) D. RNA polymerase E. Release factor F. Small ribosomal subunit i. Required for the initiation step of translation ii. Function requires binding to specific DNA sequences iii. Function requires binding to specific RNA sequences iv. Can be found in the nucleus of a eukaryote

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

25 45. (17 pts) You are studying biosynthesis of the amino acid serine in bacteria. Serine production is essential for survival. You know that there are 3 steps in this pathway as shown in Fig 2. You know that each step is catalyzed by a single enzyme. However, you don’ t know the order in which the enzymes act. You discover 3 mutant strains of bacteria that each make one inactive enzyme in this pathway. You grow each mutant in media containing the indicated compounds and observe the phenotypes shown in Fig 2. Fig. 2. A. (9 pts) Given the results in Fig 2, which enzyme most likely catalyzes each step in serine biosynthesis? Note that each of the steps is catalyzed by a different enzyme. Step 1 is most likely catalyzed by (Enzyme Z, Q or S): _____ _________________ Step 2 is most likely catalyzed by (Enzyme Z, Q or S): _____ _________________ Step 3 is most likely catalyzed by (Enzyme Z, Q or S): _____ _________________ B. (4 pts) Explain why bacteria with an inactive Enzyme Z die when grown in media containing 3PG. (1-2 sentences) C. (4 pts) You discover that the frequency of the allele encoding the mutant Enzyme Z increases in a bacterial population grown continuously in media supplemented with serine. Explain how this could occur. (1-2 sentences)

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

26 46. (20 pts) In class we have discussed an enzyme called cAMP-dependent Protein Kinase A (PKA). You are studying a different kinase called DUB kinase that has a different substrate from PKA. A. (4 pts) Based on what we have learned about enzymes and kinases in general and the active site of PKA, in particular, how would you expect the structure and function of DUB kinase to be similar to that of PKA? (2-3 sentences) You perform an experiment to measure the impact of temperature on DUB kinase activity. To help you measure DUB kinase activity you take advantage of a Chemical Indicator that turns yellow when it is phosphorylated by DUB kinase. You incubate DUB kinase and the Chemical Indicator at the indicated temperatures (black bars). You are also interested in the effect of Protein X on DUB kinase activity, so you incubate DUB kinase and the chemical indicator in the presence of Protein X at the indicated temperatures (grey bars). Protein X does not disrupt the overall structure of DUB kinase. B. (12 pts) Based on your understanding of protein structure and enzymes in general, provide a molecular explanation for the pattern of DUB kinase activity observed in Fig 3 at each temperature in the absence of Protein X (black bars). 15°C (1-2 sentences): 37°C (1-2 sentences): 80°C (1-2 sentences): C. (4 pts) Based on your understanding of enzyme regulation, provide a possible explanation for the pattern of DUB kinase activity observed in Fig 3 in the presence of Protein X (grey bars). Remember that Protein X does not disrupt the overall structure of DUB kinase (1-2 sentences) Fig. 3. All samples contain a constant amount of DUB kinase and Chemical Indicator. Error bars indicate Standard Error.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

27 47. (22 pts.) You are a researcher studying tRNAs and translation. In your research, you identify a mutant strain of bacteria that has a mutation in a specific tRNA gene that changes the anticodon sequence in the tRNA from 5’ -CUU- 3’ to 5’ -AUC- 3’. No other parts of the tRNA gene are changed. A. (8 pts) Complete the table below : tRNA gene Anticodon in tRNA Codon recognized by the indicated tRNA Be sure to label 5’ and 3’ ends. Wild-type 5’ -CUU- 3’ Mutant 5’ -AUC- 3 B. (3 pts) Importantly, you realize that since no other parts of the tRNA gene are changed, the tRNA transcribed form the mutant tRNA gene will carry the same amino acid as the wild-type tRNA. Using the codon table on the next page , w rite the amino acid carried by both the wild-type and mutant tRNAs (Hint: You may find it useful to work this problem on scratch paper first) : ____________ C. (5 pts) You introduce this mutant tRNA gene into a bacterial cell that already has a normal functioning set of tRNA genes. What changes in primary amino acid structure, would you expect to find in newly translated proteins in this novel bacterial cell? Refer to the table above and the codon table on the next page as needed. (1-2 sentences) D. (6 pts) What impact would you expect this/these change(s) in primary structure to have on protein structure and function in bacteria carrying this mutant tRNA gene? Refer to the amino acid classification table on the next page. (2-3 sentences) Create your own practice exam questions! See the next page for “madlib” templates you can use to create your own practice exam questions to answer with your study groups.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

28 Below are templates for creating questions focused either on information flow or on structure/function: Core concept: Information Flow Possible Templates: You have discovered a ( bacteria, eukaryote ) that ( has a particular mutation ) in ( a particular step in the central dogma ). What phenotype will this organism have in response to this mutation? You have discovered a ( bacteria, eukaryote ) that ( has a particular phenotype ) in ( a step in the central dogma ). What mutation could cause this phenotype? Example Exam question addressing this concept: You have discovered a strain of E. coli in which many of its proteins contain leucines in place of isoleucines. What mutation could cause this phenotype? Core concept: Structure Function Possible Template: ( Name of a molecule/cellular component ) has ( a particular function ). How is the structure of ( molecule/cellular component ) optimized for its function? OR How would ( a specific change ) in the structure of ( this molecule/cellular component ) impact its function? Example Exam question addressing this concept: DNA is the information storage molecule in the cell. How does the structure of DNA make it a better storage molecule than RNA?

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

BIOL+200+-+2024+Winter+-+Practice+Questions+-+Exam+1

Related Documents