BLAST_exercise_in_class

docx

School

York University *

*We aren’t endorsed by this school

Course

4290

Subject

Biology

Date

Feb 20, 2024

Type

docx

Pages

Uploaded by ProfessorScorpion8154

BIOL 4290 BLAST in-class assignment 2023-10-02 BIOL 4290: In-class group assignment: using Nucleotide BLAST to determine the size of the PAP PCR fragment BLAST is a bioinformatics tool that find regions of similarity between biological sequences. When biological sequences are determined, they are loaded on servers (websites) and stored there for others to access. A very popular site is the NCBI site (below). You will use this site to examine the PAP gene, to determine where the PCR primers should bind, and where restriction enzyme sites would be. 1. Call up the NCBI site: https://blast.ncbi.nlm.nih.gov/Blast.cgi 2. You will see two BLAST choices: Nucleotide BLAST and Protein BLAST. Pick the nucleotide option! After you click on the BLAST icon, you will see the search page; Page 1 of 7

BIOL 4290 BLAST in-class assignment 2023-10-02 In order to search for a particular DNA sequence you need to know some information. 3. Copy and paste the PAP sequence (see below) into the query box and press “BLAST”. At the bottom of the page, you will see this block: You don’t really need to change settings from the default settings but if you want you can play with the settings to learn more. If you were unsure of your sequence or you wanted to search for similar but not identical sequences (for instance if you wanted to find the same gene in other species), you could change the setting from Highly Similar (see above) to somewhat similar etc.  Once you insert your sequence (again below) in the Query box and hit the BLAST icon, it will take a few minutes to get results. As an example, I searched for a different sequence (yeast dUTPase) and got this result: Page 2 of 7

BIOL 4290 BLAST in-class assignment 2023-10-02 You’ll note that several options pop up. Many people can upload the sequence for the gene – often having slight differences in sequence leading to multiple entrys. Also the gene may have introns (genomic source sequencing) and so if the sequencing template was from a cDNA template, an entry deduced from that source will lack introns and even though the sequence represents the same gene, they will have different sequences. Also, there are several different isoforms of genes - again leading to multiple entries. You want to find one with the highest percentage similarity (can you see that in the picture above?). The gene is the DUT1 gene from Saccharomyces cerevisiae and has an accession number of X7463.1. This number is essentially a catalogue number. Q – What do the prefixes on the Accession numbers refer too? (ie NM, CP, X, etc) It refers to which data base that collected this data  Click the Accession number to get the information for this gene. Here is the DUT information; Page 3 of 7

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

BIOL 4290 BLAST in-class assignment 2023-10-02 Do you see any exons? Page 4 of 7

BIOL 4290 BLAST in-class assignment 2023-10-02 This page has important information including literature sources, name of the protein the gene encodes, the position of the cds (ORF), the protein amino acid sequence (bracketed in red by me – this won’t be on the webpage), and the complete DNA sequence of the entry (boxed in green by me). You’ll note that there are numbers on the DNA sequence indicating the number of nucleotides. In this entry there are 60 bases on each line. If you were to use this sequence for further searching, the numbers actually get in the way so it is better to use the FASTA sequence. 4. Look at the top left of the results page and you will see FASTA. Click on that to get the FASTA sequence. You can copy and paste this sequence for further searching/work.  There are many programs to analyze the DNA. You can search the PAP DNA sequence for;  Cds  Position of primer binding  Restriction sites  Presence of exons  Many others!  You can copy the sequence and search for primer binding sites using a text editor and control F (as one method). Remember though, that you will have to use the complementary sequence for one of the primers! The BLAST results will show you the position of the cds.  You can also use the SNAPGENE viewer to analyze your gene sequence: SnapGene Viewer | Free software for plasmid mapping, primer design, and restriction site analysis . Page 5 of 7

BIOL 4290 BLAST in-class assignment 2023-10-02 Names: 1. You have a portion of the PAP gene sequence of Phytolacca americana : Portion of the gene sequence: ATACAATCATCTACAATGTTGGAAGTACCACCATTAGCAAATACGCCACTTTTCTGAATGATCTTCGTAA TGAAGCGAAAGATCCAAGTTTAAAATGCTATGGAATACCAATGCTGCCCAATACAAATACAAATCCAAAG TACGTGTTGGTTGAGCTCCAAGGTTCAAATAAAAAAACCATCACACTAATGCTGAGACGAAACAATTTGT ATGTGATGGGTTATTCTGATCCCTTTGAAACCAATAAATGTCGTTACCATATCTTTAATGATATCTCAGG TACTGAACGCCAAGATGTAGAGACTACTCTTTGCCCAAATGCCAATTCTCGTGTTAGTAAAAACATAAAC TTTGATAGTCGATATCCAACATTGGAATCAAAAGCGGGAGTAAAATCAAGAAGTCAGGTCCAACTGGGAA a. What is the accession number of the PAP gene that most likely codes for this protein? AY547315.1 b. How long is the PAP gene? 942 bp c. How long is the PAP protein? 313 aa 2. What is the expected size of the resulting RT-PCR product from Lab 1? Using a gene map which includes relevant positions, i.e., bp positions: a) Show where all primers bind on the PAP sequence including the RT primer. b) Highlight the PCR fragment. Primer Information: Reverse Primer Sequence: 5’ CACTATCCACTTGGCACCACTG 3’ PCR forward primer: 5’ CAATGTTGGAAGTACCACCATTAGC 3’ RT Primer: (Hint – found near the 3’ end of the PAP sequence - why?): 5’ AGGCTTGATTTCATCCACT 3. Does the predicted PCR product match the results you obtained in the lab? Page 6 of 7

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

BIOL 4290 BLAST in-class assignment 2023-10-02 4. Could you use the PCR fragment to clone into a plasmid that could then be expressed (made into an active protein) in a cell? Why of why not? Yes if the PCR fragment is complementary to the restriction sites of the plasmid. Page 7 of 7

Related Documents

Week 1 Quiz.docx

Blood Lab Worksheet.docx

A10_Seno_Cristopher.docx

A7_Seno_Cristopher.docx

Lab 4 Digestive System_.pdf

Unknown Insert Report.pdf

Copy of Lab 2 Equipment Post-lab_Sp23.pdf

SCI200_Section_016_Week_01_Quizz_2.docx

Digestive System Lab Report.docx

Animal Tissues Lab Report.docx

Immunity Lab Report.docx

Population Ecology Lab Report.docx

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co...

Biology

ISBN:9781305251052

Author:Michael Cummings

Publisher:Cengage Learning

Case Studies In Health Information Management

Biology

ISBN:9781337676908

Author:SCHNERING

Publisher:Cengage

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...

Biology

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cengage Learning

Biology 2e

Biology

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:OpenStax

Basic Clinical Laboratory Techniques 6E

Biology

ISBN:9781133893943

Author:ESTRIDGE

Publisher:Cengage

SEE MORE TEXTBOOKS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage