Concept explainers
Case summary:
A hypothetical situation is provided in which the muscle which is exhibiting rigor mortis is provided with sudden increase in the ATP concentration.
Adequate information:
Rigor mortis is the condition in which the muscle cells are not able to relax due to fall in the ATP levels. If ATP is provides, the cells might get back to the relaxed state with several other changes.
To determine:
The response to the sudden increase in ATP while the body is exhibiting rigor mortis.
Given information:
A situation that shows increase in ATP concentration in a muscle that exhibits rigor mortis.
Introduction:
The binding of ATP with the myosin filaments does not occur due to too little ATP in the muscle. This leads to a state where no contraction of the muscle can take place. This happens because the actin-myosin cross-bridge is not released as there is no binding of ATP as the myosin heads. The same condition occurs when the muscles of a dead person do not contract or relax which leads to the rigidity of the muscles. This condition is known as the rigor mortis.

Want to see the full answer?
Check out a sample textbook solution
Chapter 9 Solutions
SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning


