SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781264802463
Author: VanPutte
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9, Problem 6CT
Summary Introduction
To analyze:
The composition of muscle tissue in gastrocnemius muscle in athletes.
Introduction:
The gastrocnemius muscle is the type of muscle which is located on the back portion of the lower leg. It is the larger calf muscle. It possesses a high proportion of fast-twitch fibers. It has a medial head and a lateral head which are supplied with the artery.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 9 Solutions
SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
Ch. 9.1 - List and describe the functions performed by...Ch. 9.1 - State the functions of smooth and cardiac muscle...Ch. 9.1 - Using table 9.1, distinguish among skeletal,...Ch. 9.2 - Identify the four specialized functional...Ch. 9.2 - Outline the differences in control and function...Ch. 9.3 - Name the connective tissue layers that surround...Ch. 9.3 - What are motor neurons? How do the axons of motor...Ch. 9.3 - What is the origin of muscle fibers? How do you...Ch. 9.3 - What are T tubules and the sarcoplasmic reticulum?Ch. 9.3 - Prob. 10AYP
Ch. 9.3 - Prob. 11AYPCh. 9.3 - Prob. 12AYPCh. 9.3 - Prob. 13AYPCh. 9.3 - Prob. 14AYPCh. 9.3 - Prob. 15AYPCh. 9.3 - Prob. 16AYPCh. 9.3 - Prob. 17AYPCh. 9.4 - What type of ion channel contributes to the...Ch. 9.4 - What are the two types of gated ion channels in...Ch. 9.4 - Prob. 20AYPCh. 9.4 - Prob. 21AYPCh. 9.4 - List the two types of voltage-gated channels the...Ch. 9.4 - Prob. 23AYPCh. 9.4 - Prob. 24AYPCh. 9.4 - Prob. 25AYPCh. 9.4 - Prob. 26AYPCh. 9.4 - Describe the structure of a neuromuscular...Ch. 9.4 - Prob. 28AYPCh. 9.4 - Prob. 29AYPCh. 9.4 - Prob. 30AYPCh. 9.4 - Prob. 31AYPCh. 9.4 - What ion is necessary for movement of the...Ch. 9.4 - Describe the steps in cross-bridge cycling. How is...Ch. 9.4 - Prob. 34AYPCh. 9.5 - List the phases of a muscle twitch, and describe...Ch. 9.5 - Prob. 36AYPCh. 9.5 - Prob. 37AYPCh. 9.5 - Prob. 38AYPCh. 9.5 - Prob. 39AYPCh. 9.5 - How does the lack of on unresponsive period in...Ch. 9.5 - Distinguish between active tension and passive...Ch. 9.5 - Prob. 42AYPCh. 9.5 - Prob. 43AYPCh. 9.5 - What is muscle tone, and how is it maintained?Ch. 9.6 - Contrast the structural and physiological...Ch. 9.6 - Prob. 46AYPCh. 9.6 - Prob. 47AYPCh. 9.6 - What factors contribute to increases in muscle...Ch. 9.6 - Prob. 49AYPCh. 9.6 - Prob. 50AYPCh. 9.7 - What is fatigue? List the three locations where...Ch. 9.7 - Prob. 52AYPCh. 9.7 - Prob. 53AYPCh. 9.7 - List the energy sources used to synthesize ATP for...Ch. 9.7 - Prob. 55AYPCh. 9.7 - Prob. 56AYPCh. 9.7 - Prob. 57AYPCh. 9.7 - Prob. 58AYPCh. 9.8 - Describe a typical smooth muscle cell. How do its...Ch. 9.8 - Prob. 60AYPCh. 9.8 - Prob. 61AYPCh. 9.8 - Compare visceral smooth muscle and multiunit...Ch. 9.8 - Prob. 63AYPCh. 9.8 - Prob. 64AYPCh. 9.8 - How are spontoneous contractions produced in...Ch. 9.8 - Prob. 66AYPCh. 9.8 - Prob. 67AYPCh. 9.8 - Prob. 68AYPCh. 9.9 - Prob. 69AYPCh. 9.9 - Prob. 70AYPCh. 9.10 - Prob. 71AYPCh. 9 - Which of these is true of skeletal muscle? a....Ch. 9 - Prob. 2RACCh. 9 - Prob. 3RACCh. 9 - Each myofibril Is made up of many muscle fibers....Ch. 9 - Prob. 5RACCh. 9 - Which of these statements about the molecular...Ch. 9 - Prob. 7RACCh. 9 - Prob. 8RACCh. 9 - Prob. 9RACCh. 9 - Prob. 10RACCh. 9 - Prob. 11RACCh. 9 - Prob. 12RACCh. 9 - Prob. 13RACCh. 9 - With stimuli of increasing strength, which of...Ch. 9 - Considering the force of contraction of a skeletal...Ch. 9 - Which of these events occurs during the lag...Ch. 9 - Prob. 17RACCh. 9 - Prob. 18RACCh. 9 - Given the conditions: (1) low ATP levels (2)...Ch. 9 - Prob. 20RACCh. 9 - Prob. 21RACCh. 9 - Prob. 22RACCh. 9 - Prob. 23RACCh. 9 - Prob. 24RACCh. 9 - Which of these statements concerning aging and...Ch. 9 - Prob. 1CTCh. 9 - A patient is thought to be suffering from either...Ch. 9 - Design an experiment to test the following...Ch. 9 - Explain what is happening at the level of...Ch. 9 - Predict the shape of an active tension curve for...Ch. 9 - Prob. 6CTCh. 9 - Prob. 7CTCh. 9 - Prob. 8CTCh. 9 - Prob. 9CTCh. 9 - Prob. 10CTCh. 9 - Prob. 11CTCh. 9 - Prob. 12CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:CengageBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
KINE 2310-Chapter 4: Philosophy of Physical Activity; Author: HBU Online Course Development;https://www.youtube.com/watch?v=8Ky6t3nvP_4;License: Standard youtube license