Biology: The Unity and Diversity of Life (Looseleaf)
15th Edition
ISBN: 9781337408417
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 3SQ
In cells, most RNA molecules are ___ ; most DNA molecules are ___ .
- a. single-stranded; double-stranded
- b. double-stranded; single-stranded
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A DNA nucleotide is made of all of the following components except ____.
A. a nitrogen-containing base
B. deoxyribose sugar
C. phosphate
D. phospholipids
QUESTION 2
Messenger RNA carries genetic information from the chromosomes to the ____.
A. ribosomes
B. endoplasmic reticulum
C. nucleolus
D. plasmids
QUESTION 3
3. A ___ codes for a specific sequence of amino acids in a protein.
A. gene
B. nucleotide
C. polyribosome
D. nucleic acid
QUESTION 4
4. The study of the structure, function, and interaction of cellular proteins is called ____.
A. bioinformatics
B. proteomics
C. genomics
D. haplotypics
QUESTION 5
5. Free-living organisms with a foreign gene are called ____ organisms.
A. transposed
B. transmutated
C. transparent
D. transgenic
QUESTION 6
6. DNA is shaped like a/an ____.
A. alpha protein
B. double helix…
Transcription copies a _____ to a complementary _____ molecule. a. chromosome; DNA c. gene; RNA b. genome; RNA d. DNA sequence; ribosome
A DNA sequence such as the one shown below has
symmetry.
5' TGGAATTGTGAGCGGATAACAATT 3
3' ACCTTAACACTCGCCTATTGTTAA 5
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (Looseleaf)
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Additional Science Textbook Solutions
Find more solutions based on key concepts
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (3rd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In E. coli, the genetic material is composed of ________. linear, double-stranded DNA circular, double-stranded DNA RNA and protein circular, double-stranded RNA polypeptide chainsarrow_forwardObserve the DNA strand (see pictures). The following table shows this same DNA strand, a short segment of DNA code. It codes for one specific protein, so this segment of code represents a A. Gene B. Chromosome C. Codonarrow_forwardphosphodiester bonds 8 0-P-03 H₂C 8 H₂C5 OH 0-0-0- H₂C 0-6-0 H₂C OH 2 purine **** pyrimidine T Strand X OH CH₂ 01110 CH₂ FO CH₂ 66110 CH₂ O HO-1-0arrow_forward
- If a DNA strand has the sequence ATGCGATCCGC thenthe sequence on the complementary DNA strand is _____.a. ATGCGATCCGCb. TACGCTAGGCGc. UACGCUAGGCGd. AUGCGAUCCGCarrow_forwardMolecule involved in joining segmented nucleotide strands is... O a. DNA ligase O b. Ribosomes c. RNA polymerase d. DNA polymerase ge F5 F6 F7 F10 Scrol F8 F9arrow_forwardFor each species, all ___ in the complete set of chromosomes is the ___. A.| genomes; library B.| mRNA; start of cDNA C.| DNA; genome D.| cDNA; start of mRNAarrow_forward
- Reverse transcriptase assembles a(n)_____ on a(n)_____ template. a. mRNA; DNA c. DNA; ribosome b. cDNA; mRNA d. protein; mRNAarrow_forwardWhich of the following statements is a lie? Select one: a. In humans, the genetic code is stored in 46 double-stranded DNA molecules. b. DNA packaging of prokaryotes into compact sizes is distinct to eukaryotic DNA packaging. c. Plasmids cause bacterial mutation and diversification thus they are essential components for cellular reproduction.arrow_forwardDuring the synthesis of a DNA molecule, nucleotides are added sequentially to the growing DNA molecule via bonds between the previously added nucleotide and the next nucleotide. The figure below illustrates a partial strand of a DNA molecule. W, X, Y, and Z denote differ- ent chemical bonds on the DNA strand. 5' end OH 0-P-0 A W B X с o Y 0 3' end The molecular structure of a DNA strand D Z OP 0 0X CH, -0- Which of the four labeled bonds was last to form during DNA synthesis? W CH, OHarrow_forward
- Refer to Figure 2 and compare this with the DNA model in Figure 1. a. In what ways are they similar? b. In what ways are they different? c. What is the biological significance of such differences? Why is the DNA referred to as the genetic material?arrow_forwardFor each species, all______ in the complete set of chromosomes is the____ . a. genomes; library c. mRNA; start of cDNA b. DNA; genome d. cDNA; start of mRNAarrow_forward3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the atoms that comprise the backbone of the nucleic acid chain. c. write the nucleotide sequence of this DNA segment. P-OCH, CH, HN OP-OCH, NH, OCH, OH 4. A DNA strand has the sequence ATGGCAATCCTCAAACGCTGT a. What is the sequence of the complementary DNA strand? b. What is the sequence of the mRNA that would be produced during transcription from the original strand of DNA? 5. Write the codon on mRNA that would pair with each tRNA anticodon. a. UUG b. GAA c. UCC d. CACarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY