Whether the melting temperature will be higher or lower if an RNA duplex oligonucleotide with sequence UAAUACGACUCACUAUAGGG is constructed. Concept introduction: At higher melting temperature DNA undergoes denaturation as doubles strands are broken down into single strands. The melting temperature of DNA molecules depend on the content of GC, length of DNA, nucleotide sequences, and stability of DNA molecule. Stability of DNA is determined by interactions between bases, between bases and water and base stacking interactions within adjacent bases.

Question

The preferred substrate is T because the enzyme half-saturates at 7.00 mM for T, but requires 28.0 mM for U, and 112 mM for S. b Question Content Area The rate constant k 2 with substrate S is 9.60×107 sec-1, with substrate T, k 2 = 6.00×104 sec-1, and with substrate U, k 2 = 2.40×106 sec-1. Calculate the catalytic efficiency with S, T, and U. Catalytic efficiency with S = Catalytic efficiency with T = Catalytic efficiency with U = Does enzyme A use substrate S, substrate T, or substrate U with greater catalytic efficiency?

Answer 1

Question

Chapter 8, Problem 7P

Summary Introduction

To determine: Whether the melting temperature will be higher or lower if an RNA duplex oligonucleotide with sequence UAAUACGACUCACUAUAGGG is constructed.

Concept introduction:

At higher melting temperature DNA undergoes denaturation as doubles strands are broken down into single strands. The melting temperature of DNA molecules depend on the content of GC, length of DNA, nucleotide sequences, and stability of DNA molecule. Stability of DNA is determined by interactions between bases, between bases and water and base stacking interactions within adjacent bases.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

The preferred substrate is T because the enzyme half-saturates at 7.00 mM for T, but requires 28.0 mM for U, and 112 mM for S. b Question Content Area The rate constant k 2 with substrate S is 9.60×107 sec-1, with substrate T, k 2 = 6.00×104 sec-1, and with substrate U, k 2 = 2.40×106 sec-1. Calculate the catalytic efficiency with S, T, and U. Catalytic efficiency with S = Catalytic efficiency with T = Catalytic efficiency with U = Does enzyme A use substrate S, substrate T, or substrate U with greater catalytic efficiency?

Fumerase catalyzes the conversion of fumerate to malate. fumerate + H2O ⇋ malate The turnover number, kcat, for fumerase is 8.00×102 sec-1. The Km of this enzyme for fumerate is 5.00×10-3 μmol mL-1. a In an experiment using 2.00×10-3 μmol·mL-1, what is Vmax?

Suppose you wanted to make a buffer of exactly pH 7.00 using KH2PO4 and Na2HPO4. If the final solution was 0.18 M in KH2PO4, you would need 0.25 M Na2HPO4. Now assume you wish to make a buffer at the same pH, using the same substances, but want the total phosphate molarity ([HPO42−]+[H2PO−4]) to equal 0.20 M. What concentration of the Na2HPO4 would be required?