MICROBIOLOGY-MASTERING MICRO.-ACCESS
11th Edition
ISBN: 9780321802705
Author: Tortora
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 4R
The following is a code for a strand of DNA.
- a. Using the genetic code provided in Figure 8.8, fill in the blanks to complete the segment of DNA shown.
- b. Fill in the blanks to complete the sequence of amino acids coded for by this strand of DNA.
- c. Write the code for the complementary strand of DNA completed in part (a).
- d. What would be the effect if C were substituted for T at base 10?
- e. What would be the effect if A were substituted for G at base 11?
- f. What would be the effect if G were substituted for T at base 14?
- g. What would be the effect if C were inserted between bases 9 and 10?
- h. How would UV radiation affect this strand of DNA?
- i. Identify a nonsense sequence in this strand of DNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The template strand of a segment of double-helical DNA contains the sequence –
5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’
a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends.
b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends.
c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’
a. Write the sequence for the complementary DNA strand.
b. Write the sequence of the RNA complementary to the strand shown
Chapter 8 Solutions
MICROBIOLOGY-MASTERING MICRO.-ACCESS
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Prob. 5RCh. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...
Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (2nd Edition)
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (3rd Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by transcribing the bottom DNA code c. fill in the correct tRNA bases d. translate the MRNA codons to find the correct amino acids Example #1 5' 3' (A (A DNA MRNA TRNA Amino Acidsarrow_forwardDetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forwardGive the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’arrow_forward
- Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forwardThe following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forwardDetermine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence. Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)arrow_forward
- Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence. Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) 3' TACATGGTTGTGCTAATT 5' Carrow_forwardConsider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardConsider how histone proteins bind to DNA and then explain why a salt solution with a high concentration can remove them from DNA (as shown in Figure 12.21b).arrow_forwardIn your own wordsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY