GENETICS(LL)-W/CONNECT >CUSTOM<
6th Edition
ISBN: 9781260571561
Author: HARTWELL
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 33P
The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA.
5′ CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3′
3′ GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG 5′
a. | Which strand is the template strand? In which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? |
b. | What is the sequence of the |
c. | A single base mutation in the gene results in synthesis of the peptide Met Tyr Thr. What is the sequence of nucleotides making up the mRNA produced by this mutant gene? |
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Case Study—Ella
Ella has a family history of diabetes. She wants to follow a healthful eating pattern that can lower her risk for developing this condition. Her dietitian recommends a goal of 450 to 600 kcal per meal and advises Ella to follow the Acceptable Macronutrient Distribution Range (AMDR) for carbohydrates and the Dietary Guidelines for Americans 2015-2020, which recommend limiting added sugar. She also recommends that Ella choose whole grains rather than processed grains. Ella decides to pack a lunch to take to work every day. This morning she’s making a sandwich for her lunch.
Categories of Sandwich Options (Top of the screen)
Breads
Spreads
Cheeses
Vegetables
Proteins
Specific food items to select
White Bread 6-inches
Honey Mustard
Provolone
LettuceTomatoBell Peppers
Turkey
Part A - Reading Nutrition Facts Panels for Total Kilocalories
How many total kilocalories are in Ella’s sandwich?
_______ kcal ?
Part B - Reading Nutrition Facts Panels for…
Case Study—Ella
Ella has a family history of diabetes. She wants to follow a healthful eating pattern that can lower her risk for developing this condition. Her dietitian recommends a goal of 450 to 600 kcal per meal and advises Ella to follow the Acceptable Macronutrient Distribution Range (AMDR) for carbohydrates and the Dietary Guidelines for Americans 2015-2020, which recommend limiting added sugar. She also recommends that Ella choose whole grains rather than processed grains. Ella decides to pack a lunch to take to work every day. This morning she’s making a sandwich for her lunch.
Categories of Sandwich Options (Top of the screen)
Breads
Spreads
Cheeses
Vegetables
Proteins
Specific food items to select
White Bread 6-inches
Honey Mustard
Provolone
LettuceTomatoBell Peppers
Turkey
Part A - Reading Nutrition Facts Panels for Total Kilocalories
How many total kilocalories are in Ella’s sandwich exactl ______kcal ?
Part B - Reading Nutrition Facts Panels for…
In humans, red-green color blindness is recessive and X-linked, whereas albinism is recessive and autosomal. What types of children can be produced as the result of marriage between two homozygous parents, a normal-vision albino woman and a color-blind, normal male?
Chapter 8 Solutions
GENETICS(LL)-W/CONNECT >CUSTOM<
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In Drosophila, an X linked recessive mutation, scalloped (sd), causes irregular wing margins. Diagram the F1 and F2 results if a (a) scalloped female is crossed with a normal male; (b) a scalloped male is crossed with a normal female (assume the female is homozygous). Compare these results to what you would find if the trait was not sex linked.arrow_forwardCase Study—Ella Ella has a family history of diabetes. She wants to follow a healthful eating pattern that can lower her risk for developing this condition. Her dietitian recommends a goal of 450 to 600 kcal per meal and advises Ella to follow the Acceptable Macronutrient Distribution Range (AMDR) for carbohydrates and the Dietary Guidelines for Americans 2015-2020, which recommend limiting added sugar. She also recommends that Ella choose whole grains rather than processed grains. Ella decides to pack a lunch to take to work every day. This morning she’s making a sandwich for her lunch. Categories of Sandwich Options (Top of the screen) Breads Spreads Cheeses Vegetables Proteins Specific food items to select White Bread 6-inches Honey Mustard Provolone LettuceTomatoBell Peppers Turkey Part A - Reading Nutrition Facts Panels for Total Kilocalories How many total kilocalories are in Ella’s sandwich exactl ______kcal ? Part B - Reading Nutrition Facts Panels for…arrow_forwardC MasteringHealth MasteringNu × session.healthandnutrition-mastering.pearson.com/myct/itemView?assignment ProblemID=17465255&attemptNo=1&offset=prevarrow_forwardBiopharmaceutics and Pharmacokinetics:Two-Compartment Model Instant Absorption Questions SHOW ALL WORK, including equation used, variables used and each step to your solution, report your regression lines and axes names (with units if appropriate) :Calculate a-q a) B1, b) B2, c) hybrid rate constant (1) d) hybrid rate constant (2) e) t1/2,dist f) t1/2,elim g) k10 h) k12 i) k21 j) initial concentration (C0) k) central compartment volume (V1) l) steady-state volume (Vss) m) clearance (CL) AUC (0→10 min) using trapezoidal rule n) AUC (20→30 min) using trapezoidal rule o) AUCtail (AUC360→∞) p) total AUC (using short cut method) q) volume from AUC (VAUC)arrow_forwardGlitazones reduce insulin resistance by binding to a transcription factor in adipocytes, thereby reducing thesecretion of fatty acids. Glitazones are taken orally (in pill form). Using pharmacokinetic modeling, deriveequations to describe how the concentration of glitazones varies in the plasma as a function of time. Yourequations should be of the form: dCglitazone /dt = something, or dMglitazone /dt = something. Your model shouldinclude three compartments: the gut, the plasma, and the fatty tissues. Make sure to include a diagram thatillustrates your thinking, state all assumptions, and define your variables. Do not solve the equations.arrow_forwardCase Study—Ella Review the case study and then answer Parts A through F. Ella has a family history of diabetes. She wants to follow a healthful eating pattern that can lower her risk for developing this condition. Her dietitian recommends a goal of 450 to 600 kcal per meal and advises Ella to follow the Acceptable Macronutrient Distribution Range (AMDR) for carbohydrates and the Dietary Guidelines for Americans 2015-2020, which recommend limiting added sugar. She also recommends that Ella choose whole grains rather than processed grains. Ella decides to pack a lunch to take to work every day. This morning she’s making a sandwich for her lunch. Categories of Sandwich Options (Top of the screen) Breads Spreads Cheeses Vegetables Proteins Specific food items to select White Bread 6-inches Honey Mustard Provolone LettuceTomatoBell Peppers Turkey Part A - Reading Nutrition Facts Panels for Total Kilocalories How many total kilocalories are in Ella’s sandwich? _____…arrow_forward, if one of the archaeological specimens lacked the celiac disease-causing epitope, how could PCR be used to identify the allele in a contemporary germplasm collection of wild wheats, and to assist in transferring the allele to modern wheat varieties?arrow_forwardNow you will consider the composition of lipoproteins, including where they are synthesized, how they circulate, and where the various lipid and protein components are located within the lipoprotein molecule. Drag the appropriate labels to their respective targets.arrow_forwardThe Oregon Wolfe Barley mapping population is unique in having 12 easily-scored morphological markers, each showing monogenic inheritance. Do you consider these markers useful? Briefly defend your answer, pointing out advantages and disadvantages of morphological vs. molecular markers.arrow_forwardBiopharmaceutics and Pharmacokinetics:Two-Compartment Model Instant Absorption Questions Calculate these : a) B1, b) B2, c) hybrid rate constant (1) d) hybrid rate constant (2) e) t1/2,dist f) t1/2,elim g) k10 h) k12 i) k21 j) initial concentration (C0) k) central compartment volume (V1) l) steady-state volume (Vss) m) clearance (CL) AUC (0→10 min) using trapezoidal rule n) AUC (20→30 min) using trapezoidal rule o) AUCtail (AUC360→∞) p) total AUC (using short cut method) q) volume from AUC (VAUC)arrow_forwardIn a population of Jackalopes (pictured below), horn length will vary between 0.5 and 2 feet, with the mean length somewhere around 1.05 feet. You pick Jackalopes that have horn lengths around 1.75 feet to breed as this appears to be the optimal length for battling other Jackalopes for food. After a round of breeding, you measure the offsprings' mean horn length is 1.67. What is the heritability of horns length (h2)? Is Jackalope horn length a heritable trait? (4 pts)? 12pt v R Paragraph V BIU A श्र > Barrow_forwardThere are many differences between DNA replication happening during mitosis in a Douglas fir tree growing in the Oregon Cascade Mountains and DNA replication happening during a PCR reaction in a forestry research lab at Oregon State University where the laboratory is amplifying a Simple Sequence Repeat. Complete the following table that compares the two DNA replication events in terms of the primers, the nucleotides, the polymerase, and the target sequence. Additionally, give a general value for the number of copies of the template DNA after one S phase in one cell and after the lab has completed the PCR reaction. Tree SSR Type your answer here: Primers Nucleotides Polymerase Target sequence Number of copiesarrow_forwardarrow_back_iosSEE MORE QUESTIONSarrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY