GENETICS(LL)-W/CONNECT >CUSTOM<
6th Edition
ISBN: 9781260571561
Author: HARTWELL
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 33P
The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA.
5′ CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3′
3′ GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG 5′
a. | Which strand is the template strand? In which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? |
b. | What is the sequence of the |
c. | A single base mutation in the gene results in synthesis of the peptide Met Tyr Thr. What is the sequence of nucleotides making up the mRNA produced by this mutant gene? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following is the process that is "capable of destroying all forms of microbial life"?
Question 37 options:
Surgical scrub
Sterilization
Chemical removal
Mechanical removal
After you feel comfortable with your counting method and identifying cells in the various stages of mitosis, use the four images below of whitefish blastula to count the cells in each stage until you reach 100 total cells, recording your data below in Data Table 1. (You may not need to use all four images. Stop counting when you reach 100 total cells.)
After totaling the cells in each stage, calculate the percent of cells in each stage. (Divide total of stage by overall total of 100 and then multiply by 100 to obtain percentage.)
Data Table 1Stage Totals PercentInterphase Mitosis: Prophase Metaphase Anaphase Telophase Cytokinesis Totals 100 100%
To find the length of time whitefish blastula cells spend in each stage, multiply the percent (recorded as a decimal, in other words take the percent number and divide by 100) by 24 hours. (Example: If percent is 20%, then Time in Hours = .2 * 24 = 4.8) Record your data in Data…
What are Clathrin coated vesicles and what is their function?
Chapter 8 Solutions
GENETICS(LL)-W/CONNECT >CUSTOM<
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How is a protein destined for the Endoplasmic Reticulum (ER), imported into the ER? Be concise.arrow_forwardFind out about the organisations and the movements aimed at the conservation of our natural resources. Eg Chipko movement and Greenpeace. Make a project report on such an organisation.arrow_forwardWhat are biofertilizers and mention the significancearrow_forward
- PCBs and River Otters: Otters in Washington State’s Green-Duwamish River have high levels of polychlorinated biphenyls (PCBs) in their livers. PCBs can bind to the estrogen receptors in animals and disrupt the endocrine system of these otters. The PCBs seem to increase the estrogen to androgen ratio, skewing the ratio toward too much estrogen. How would increased estrogen affect the river otter population? Based on your reading of the materials in this unit, what factors can affect fertility in humans? Explain how each of the factors affecting human fertility that you described can disrupt the human endocrine system to affect reproduction.arrow_forwardOther than oil and alcohol, are there other liquids you could compare to water (that are liquid at room temperature)? How is water unique compared to these other liquids? What follow-up experiment would you like to do, and how would you relate it to your life?arrow_forwardSelection of Traits What adaptations do scavengers have for locating and feeding on prey? What adaptations do predators have for capturing and consuming prey?arrow_forward
- Competition Between Species What natural processes limit populations from growing too large? What are some resources organisms can compete over in their natural habitat?arrow_forwardSpecies Interactions Explain how predators, prey and scavengers interact. Explain whether predators and scavengers are necessary or beneficial for an ecosystem.arrow_forwardmagine that you are conducting research on fruit type and seed dispersal. You submitted a paper to a peer-reviewed journal that addresses the factors that impact fruit type and seed dispersal mechanisms in plants of Central America. The editor of the journal communicates that your paper may be published if you make ‘minor revisions’ to the document. Describe two characteristics that you would expect in seeds that are dispersed by the wind. Contrast this with what you would expect for seeds that are gathered, buried or eaten by animals, and explain why they are different. (Editor’s note: Providing this information in your discussion will help readers to consider the significance of the research).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY