
Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 19RQ
Summary Introduction
To name: Any four types of neurotransmitters and their receptors and also determine whether the receptor is an ion channel or a GPCR.
Introduction: Neurotransmitters are the substances which are released from the nerve cells to communicate with the other nerve cells. Neurotransmitters are released into the synaptic cleft and are received by the receptors of the target cells.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 8 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 8 - Organize the following terms describing functional...Ch. 8 - Where do neurohormone-secreting neurons terminate?Ch. 8 - What is the difference between a nerve and a...Ch. 8 - Draw a chain of three neurons that synapse on one...Ch. 8 - What is the primary function of each of the...Ch. 8 - Name the two glial cell types that form myelin....Ch. 8 - Given the values in Table 8.2, use the Nernst...Ch. 8 - Would a cell with a resting membrane potential of...Ch. 8 - Would the cell membrane depolarize or...Ch. 8 - Match each ions movement with the type of graded...
Ch. 8 - Prob. 11CCCh. 8 - What is the difference between conductance and...Ch. 8 - If you put ouabain, an inhibitor of the Na+-K+...Ch. 8 - The pyrethrin insecticides, derived from...Ch. 8 - When Na+ channel gates are resetting, is the...Ch. 8 - A stimulating electrode placed halfway down an...Ch. 8 - Place the following neurons in order of their...Ch. 8 - Prob. 18CCCh. 8 - Prob. 19CCCh. 8 - Prob. 20CCCh. 8 - Prob. 21CCCh. 8 - Prob. 22CCCh. 8 - Classify the H+-neurotransmitter exchange as...Ch. 8 - Prob. 24CCCh. 8 - Prob. 25CCCh. 8 - Is Na+-dependent neurotransmitter reuptake...Ch. 8 - In Figure 8.24e, assume the postsynaptic neuron...Ch. 8 - In the graphs of Figure 8.24a, b, why doesnt the...Ch. 8 - Prob. 29CCCh. 8 - Prob. 30CCCh. 8 - List the three functional classes of neurons, and...Ch. 8 - Somatic motor neurons control __________, and...Ch. 8 - Prob. 3RQCh. 8 - Prob. 4RQCh. 8 - Prob. 5RQCh. 8 - Prob. 6RQCh. 8 - Axonal transport refers to the (a) release of...Ch. 8 - Match the numbers of the appropriate...Ch. 8 - Arrange the following events in the proper...Ch. 8 - List the four major types of ion channels found in...Ch. 8 - Prob. 11RQCh. 8 - An action potential is (circle all correct...Ch. 8 - Choose from the following ions to fill in the...Ch. 8 - What is the myelin sheath?Ch. 8 - List two factors that enhance conduction speed.Ch. 8 - Prob. 16RQCh. 8 - Draw and label a graph of an action potential....Ch. 8 - Prob. 18RQCh. 8 - Prob. 19RQCh. 8 - Create a map showing the organization of the...Ch. 8 - Prob. 21RQCh. 8 - Prob. 22RQCh. 8 - Prob. 23RQCh. 8 - Prob. 24RQCh. 8 - The presence of myelin allows an axon to (choose...Ch. 8 - Define, compare, and contrast the following...Ch. 8 - Prob. 27RQCh. 8 - Prob. 28RQCh. 8 - Prob. 29RQCh. 8 - Prob. 30RQCh. 8 - An unmyelinated axon has a much greater...Ch. 8 - The GHK equation is sometimes abbreviated to...Ch. 8 - In each of the following scenarios, will an action...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license