Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 8, Problem 30CC
Summary Introduction
To explain: The reason behind the driving of Mg2+ ions from the channel into the extracellular fluid during depolarization of the membrane.
Introduction: The transmission of neural signals involves the action of different types of ions and their movement between the presynaptic neuron, postsynaptic neuron, and the synapse through different types of channels. Proper ionic concentrations and normal working of the channels are very important for the transmission of neural signals.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is
equivalent to acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source.
NADH
FADH2
OP ATP
Show your work using dimensional analysis here:
SLP ATP
Total ATP
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Chapter 8 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 8 - Organize the following terms describing functional...Ch. 8 - Where do neurohormone-secreting neurons terminate?Ch. 8 - What is the difference between a nerve and a...Ch. 8 - Draw a chain of three neurons that synapse on one...Ch. 8 - What is the primary function of each of the...Ch. 8 - Name the two glial cell types that form myelin....Ch. 8 - Given the values in Table 8.2, use the Nernst...Ch. 8 - Would a cell with a resting membrane potential of...Ch. 8 - Would the cell membrane depolarize or...Ch. 8 - Match each ions movement with the type of graded...
Ch. 8 - Prob. 11CCCh. 8 - What is the difference between conductance and...Ch. 8 - If you put ouabain, an inhibitor of the Na+-K+...Ch. 8 - The pyrethrin insecticides, derived from...Ch. 8 - When Na+ channel gates are resetting, is the...Ch. 8 - A stimulating electrode placed halfway down an...Ch. 8 - Place the following neurons in order of their...Ch. 8 - Prob. 18CCCh. 8 - Prob. 19CCCh. 8 - Prob. 20CCCh. 8 - Prob. 21CCCh. 8 - Prob. 22CCCh. 8 - Classify the H+-neurotransmitter exchange as...Ch. 8 - Prob. 24CCCh. 8 - Prob. 25CCCh. 8 - Is Na+-dependent neurotransmitter reuptake...Ch. 8 - In Figure 8.24e, assume the postsynaptic neuron...Ch. 8 - In the graphs of Figure 8.24a, b, why doesnt the...Ch. 8 - Prob. 29CCCh. 8 - Prob. 30CCCh. 8 - List the three functional classes of neurons, and...Ch. 8 - Somatic motor neurons control __________, and...Ch. 8 - Prob. 3RQCh. 8 - Prob. 4RQCh. 8 - Prob. 5RQCh. 8 - Prob. 6RQCh. 8 - Axonal transport refers to the (a) release of...Ch. 8 - Match the numbers of the appropriate...Ch. 8 - Arrange the following events in the proper...Ch. 8 - List the four major types of ion channels found in...Ch. 8 - Prob. 11RQCh. 8 - An action potential is (circle all correct...Ch. 8 - Choose from the following ions to fill in the...Ch. 8 - What is the myelin sheath?Ch. 8 - List two factors that enhance conduction speed.Ch. 8 - Prob. 16RQCh. 8 - Draw and label a graph of an action potential....Ch. 8 - Prob. 18RQCh. 8 - Prob. 19RQCh. 8 - Create a map showing the organization of the...Ch. 8 - Prob. 21RQCh. 8 - Prob. 22RQCh. 8 - Prob. 23RQCh. 8 - Prob. 24RQCh. 8 - The presence of myelin allows an axon to (choose...Ch. 8 - Define, compare, and contrast the following...Ch. 8 - Prob. 27RQCh. 8 - Prob. 28RQCh. 8 - Prob. 29RQCh. 8 - Prob. 30RQCh. 8 - An unmyelinated axon has a much greater...Ch. 8 - The GHK equation is sometimes abbreviated to...Ch. 8 - In each of the following scenarios, will an action...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Awnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forward
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license