A&P CONNECT ACCESS CARD - SP
4th Edition
ISBN: 9781266185168
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 8, Problem 19DYKB
Summary Introduction
To determine:
The functions of arches of the foot.
Concept introduction:
Feet are flexible bony structures that help in running, jumping, and walking. Feet are divided into parts:
- 1. The forefoot: It consists of phalanges and metatarsals.
- 2. The midfoot: It consists of the cuboid, navicular, and three cuneiform bones.
- 3. The hind foot: It consists of talus and calcaneus.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 8 Solutions
A&P CONNECT ACCESS CARD - SP
Ch. 8.1 - What is the general function of the axial...Ch. 8.1 - What is the difference between a foramen and a...Ch. 8.2 - Prob. 3WDYLCh. 8.2 - Prob. 4WDYLCh. 8.2 - What bones form the middle cranial fossa, and...Ch. 8.2 - Prob. 6WDYLCh. 8.2 - Prob. 7WDYLCh. 8.2 - In which four bones are the paranasal sinuses...Ch. 8.3 - Prob. 9WDYLCh. 8.4 - Prob. 10WDYL
Ch. 8.4 - What are the two largest fontanelles, and when do...Ch. 8.5 - Prob. 12WDYLCh. 8.5 - What are the secondary curves, and when do they...Ch. 8.5 - Compare the locations and functions of the...Ch. 8.5 - Prob. 15WDYLCh. 8.6 - Prob. 16WDYLCh. 8.6 - Prob. 17WDYLCh. 8.7 - Prob. 18WDYLCh. 8.8 - How do the sternal end and acromial end of the...Ch. 8.8 - Prob. 20WDYLCh. 8.9 - Prob. 21WDYLCh. 8.9 - Prob. 22WDYLCh. 8.9 - Prob. 23WDYLCh. 8.9 - Describe how the radius and ulna are positioned...Ch. 8.9 - Prob. 25WDYLCh. 8.10 - What three bones fuse to form the os coxae?Ch. 8.10 - Prob. 27WDYLCh. 8.10 - How is the pelvic inlet distinguished from the...Ch. 8.10 - Prob. 29WDYLCh. 8.10 - What are some differences in the symphysial...Ch. 8.11 - Prob. 31WDYLCh. 8.11 - Prob. 32WDYLCh. 8.11 - What are some bony features that are similar or...Ch. 8.11 - Prob. 34WDYLCh. 8.11 - Prob. 35WDYLCh. 8.11 - Prob. 36WDYLCh. 8.12 - Prob. 37WDYLCh. 8 - Prob. 1DYKBCh. 8 - Which bone marking is matched with its correct...Ch. 8 - The frontal and parietal bones articulate at the...Ch. 8 - Prob. 4DYKBCh. 8 - Prob. 5DYKBCh. 8 - Prob. 6DYKBCh. 8 - Prob. 7DYKBCh. 8 - Prob. 8DYKBCh. 8 - The femur articulates with the tibia at the a....Ch. 8 - Prob. 10DYKBCh. 8 - Prob. 11DYKBCh. 8 - Prob. 12DYKBCh. 8 - What are the functions of the paranasal sinuses?Ch. 8 - Prob. 14DYKBCh. 8 - Describe similarities and differences among true,...Ch. 8 - Compare and contrast the anatomic and functional...Ch. 8 - What are the primary similarities and differences...Ch. 8 - Prob. 18DYKBCh. 8 - Prob. 19DYKBCh. 8 - Prob. 20DYKBCh. 8 - Prob. 1CALCh. 8 - Prob. 2CALCh. 8 - Prob. 3CALCh. 8 - Prob. 4CALCh. 8 - Use the following paragraph to answer questions...Ch. 8 - Prob. 1CSLCh. 8 - Prob. 2CSLCh. 8 - Forensic anthropologists are investigating...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
The Skeletal System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=f-FF7Qigd3U;License: Standard YouTube License, CC-BY