Campbell Biology in Focus, Books a la Carte Edition; Modified Mastering Biology with Pearson eText - ValuePack Access Card - for Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780134433769
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 11TYU
Summary Introduction
To explain:
Whether the DNA sequence of ribosomal RNA gene of chloroplast will be same as the one in the plant nucleus or as that of a photosynthetic bacterium and what does it say about the evolution of photosynthesis.
Concept introduction:
The endosymbiotic theory says that the eukaryotes evolved from prokaryotes. The eukaryotic plant organelle, chloroplast was originally a photosynthetic prokaryote that was engulfed by another organism.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
*00
g organisms use
nformation from
e is nearly identical
ants, and animals.
These two enzymes are found in
nearly all living organisms. When
you studied the cytoskeleton, you
learned about the proteins actin
and tubulin. Actin and tubulin are
found in all eukaryotes.
VAn actin gene in humans is
92% identical to the homologous
actin gene in mice. An actin gene
in humans is 80% identical to the
homologous gene in yeast. What
does this say about how long ago
these organisms had a common
ancestor?
rom common
lting from common
One example of
s that determine
es determine which
which become the
Key
growth of the front
ons in the Hox genes
sm's structure. Some
nost all multicellular
Hox genes must have
ncestors.
ection
at research of the
ural selection?
to observe natural selection
ge happens very slowly.
Pa
V
9.
Hi can someone help me with this question please?
O e.
A Mode of cell division in fungi
Time ſeft 1:37:
CLEAR MY CHOICE
Bacteriophages can recognize the host cell by:
O a. Binding of a viral protein to a receptor on the bacteria cell using the lock and key fit
O b. Viral envelop that fuses with the plasma membrane of a bacterial cell
O c. Binding of the viral receptor to a protein on a bacteria cell using the lock and key fit
O d. Glycoprotein that recognizes a specific protein on a bacterial cell
e. Glycoproteins that help the virus to bind to a receptor protein on a bacterial cell
All nucleic acids are:
O a.
Contain deoxyribose
O b. Polymers of nucleotides
Chapter 8 Solutions
Campbell Biology in Focus, Books a la Carte Edition; Modified Mastering Biology with Pearson eText - ValuePack Access Card - for Campbell Biology in Focus (2nd Edition)
Ch. 8.1 - How do the reactant molecules of photosynthesis...Ch. 8.1 - How did the use of an oxygen isotope help...Ch. 8.1 - WHAT IF? The Calvin cycle requires ATP and NADPH,...Ch. 8.2 - What color of light is least effective in driving...Ch. 8.2 - In the light reactions, what is the initial...Ch. 8.2 - Prob. 3CCCh. 8.3 - MAKE CONNECTIONS How are the large numbers of ATP...Ch. 8.3 - WHAT IF? Explain why a poison that inhibits an...Ch. 8.3 - Prob. 3CCCh. 8 - The light reactions of photosynthesis supply the...
Ch. 8 - Which of the following sequences correctly...Ch. 8 - How is photosynthesis similar in C4, plants and...Ch. 8 - Which of the following statements is a correct...Ch. 8 - Which of the following does not occur during the...Ch. 8 - In mechanism, photophosphorylation is most similar...Ch. 8 - Prob. 7TYUCh. 8 - To synthesize one glucose molecule, the Calvin...Ch. 8 - SCIENCE, TECHNOLOGY, AND SOCIETY Scientific...Ch. 8 - DRAW IT The following diagram represents an...Ch. 8 - Prob. 11TYUCh. 8 - Prob. 12TYUCh. 8 - FOCUS ON ENERGY AND MATIER Life is solar powered....Ch. 8 - SYNTHESIZE YOUR KNOWLEDGE Watermelon snow in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CELL A T T AG C G A CCAGTATA T C C TAC A A T C C G TCTAC T T CATTO ATTAGCG A CCA GT TT AT C CTACA ATC C C G T CTACTT CAT11 ATTAT c G AC C A GT TT AT CCT ACATT CC c G TATACTTC GT 14 АМОЕВА SPONGE EARTHWORM C T TAT C G A C c c G TT T ATC CTACA TT C C c GT CT A CTT CGT CTTAT Cc ccc CGTTTATCCTACTTTCCCGT CT A CTTCGT CT A AT c cccc c GT T T ATC CTACT TTCCC G T CT A CTT CGT CT A AT c c ccc c G T T T AT C CTA CTT T C C CATCTACTA CTA AT ccc c c c GT T TATCCTACT TT C C CAT GT AGTA TAAT Ccc c c c GT T T AT c CTACT TT C C CATCTACTAAGT SHARK LIZARD KANGAROO GT DOLPHIN GT СAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is…arrow_forward. In examining Figure 3-19, what do you think is the mainreason for the difference in size of yeast and humanmtDNA?arrow_forward5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Compare each organism's Cytochrome CDNA sequences with the ancestor cell and each other. Circle or highlight the differences (mutations) present in the cytochrome CDNA sequences from ancestor cell. ANCESTOR CE A T TAGCGAC CAGTATATC CTACAATC C G T C TACTTCATTO ATTAGCGACCAGTT TATCCTACAATCC c GTCT ACT TCAT ATTATCG ACCAGT T TATC CTACATTCCC G TATACT TCGT EARTHWOR C T TATCGACC cGT T TAT CCTACATTCCCGT CT ACTTCG T CGTT TATCCTACTTTC C c GTC TACTTC GT CGTTTATCCTACT TTC c cGT C TACTTCG T KANGAROO CTAATC C C cc cGT T TAT C cT ACT T TCCCAT CT ACTAAGT CGT T TATCCTACTT TC C CATGTAGTAA GT GTTTATCCTACTTT CCCATCTACT A A GT АМОЕВА SPONGE CTTATC C C CTAATC c c SHARK LIZARD CTAATC C c |TTAATC DOLPHIN CAT 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is shared by all the organisms on the outside. Inside each box, write the organisms that…arrow_forward
- . Which of the following characteristics of chloroplastsand/or mitochondria make them seem more similar tobacterial cells than to eukaryotic cells?a. Translation is sensitive to chloramphenicol anderythromycin.b. Alternate codons are used in mitochondria genes.c. Introns are present in organelle genes.d. DNA in organelles is not arranged innucleosomes.arrow_forwardWhich butterfly has a more active pigment-producingenzyme, the dark- or light-colored one?arrow_forward37arrow_forward
- VISUALIZE Sketch a roughly cuboidal cell preparing to divide. Indicate the orientation of the preprophase band and the site where the new cell walls of the daughter cells will form.arrow_forward2) Main component of the cell walls in plants: in fungi: bacteria: 3) What are the double-membrane bounded organelles in a cell? 4) A is the whole genetic material of an organism. Which organelles in cell have their own DNA? and Human Genome Project were created with in 1992, and completed in chromosomes and chromosomes beginning (year). 5) After the invention of by structure of biological cells has better understood. Firstly, he made observations on is used for the first time in his work. cells which were dead. The word 6) chromosome abnormalities (Trisomy21) is an example of human chromosomal disorder. Types of are 7) Order phases of cell cycle putting numbers in blue circles. is the longest phase in cell division. cells make up most of your body's tissues and organs, including skin, muscles, lungs, gut, and hair cells divide by 8) A- For each number, write their names on the right. B- Label the figure below similarly (fill in boxes). BBIX 1- 2- 3- 1 3 4 4-arrow_forwardLesson:Perpetuation of life What’s more: Answer the following questions: Are you in favor of Genetic Engineering? Yes or No? Why? If you are an expert in Genetic Engineering what would be your creation and how will it help us? Assessment: Enumerate what is/are being asked. Give at least five examples of genetic engineered plants/animals. a.b.c.d.e. Give at least 2 examples of the following: Fission- - Budding- - Fragmentation- -3. Give at least 4 examples of plants which can do Vegetative Reproduction. a. b. c. d. What’s new: If you are alone in the middle of the forest and there is now way out, what is the first thing that you are going to do or look for in order for you to survive? If you are given a chance to choose an animal to help you to survive in the middle of the forest, what would it be and why?arrow_forward
- Eukaryotic and prokaryotic ribosomes are similar in that: a. both contain a small subunit, but only eukaryotes contain a large subunit. b. both contain the same number of proteins. c. both use mRNA to assemble amino acids into proteins. d. both contain the same number of types of rRNA. e. both produce proteins that can pass through pores into the nucleus.arrow_forwardGenetic Fill in the missingarrow_forwardQ8arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax