Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7.2, Problem 1MQ
Summary Introduction
Bacterial chromosome is circular in shape. The entire genome of the prokaryotes lies in this circle however in some cases additional circles are seen known as plasmids. Reproduction in bacteria occurs by binary fission. When the bacterial DNA (deoxyribo
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the scenario where a single strand break occurs in the DNA replication fork:
a)
What would happen if RecC failed to bind to the chi site? Explain briefly and draw out the step
at which recombinational DNA repair would stall.
b)
What would happen if RecA failed to bind DNA? Explain briefly and draw out the step at which
recombinational DNA repair would stall.
c)
Draw the resolved product of this Holliday junction if it's cleaved in the direction of the white
triangles. Is the result a heteroplex or recombinant?
A
Strand
Invasion
Ⓒ Holliday
Junction
A
Resolve
What is the difference from the polymerase used in transcription of mRNA and the polymerase
used during DNA replication that occurs in the S Phase of interphase?
What is
During the resolution of the two Holliday junctions, how many strands of DNA in total are broken during this process? Does the number differ depending on if this leads to recombination or non-recombination?”
Chapter 7 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 7.1 - What is the utility of a reporter gene?Ch. 7.1 - Prob. 2MQCh. 7.1 - Prob. 1CRCh. 7.2 - Prob. 1MQCh. 7.2 - Prob. 2MQCh. 7.2 - Prob. 1CRCh. 7.3 - What is the divisome?Ch. 7.3 - How does FtsZ find the cell midpoint of a...Ch. 7.3 - What is the role of the penicillin-binding protein...Ch. 7.4 - How does MreB control the shape of a rod-shaped...
Ch. 7.4 - What protein is thought to control the shape of...Ch. 7.4 - What relationships exist between cytoskeletal...Ch. 7.4 - What morphology do cells have that lack MreB or...Ch. 7.5 - Prob. 1MQCh. 7.5 - What is transpeptidation and why is it important...Ch. 7.5 - Prob. 1CRCh. 7.6 - How are different sets of genes expressed in the...Ch. 7.6 - Prob. 2MQCh. 7.6 - Prob. 1CRCh. 7.7 - Why are the levels of DnaA protein controlled...Ch. 7.7 - Prob. 2MQCh. 7.7 - Prob. 1CRCh. 7.8 - Prob. 1MQCh. 7.8 - What is the major transcriptional regulator that...Ch. 7.8 - What is meant by "patterning" during heterocyst...Ch. 7.9 - What are the four basic stages of biofilm...Ch. 7.9 - Besides autoinducer synthesis, what intracellular...Ch. 7.9 - What type of genes does c-di-GMP activate during...Ch. 7.10 - Describe two targets of antibiotics and discuss...Ch. 7.10 - Prob. 2MQCh. 7.10 - Prob. 3MQCh. 7.10 - Prob. 1CRCh. 7.11 - Is persistence a heritable trait?Ch. 7.11 - What prevents the toxin component of TA modules...Ch. 7.11 - Prob. 3MQCh. 7.11 - Prob. 1CRCh. 7 - If DnaA was not regulated in Escherichia coli and...Ch. 7 - Explain how cells exhibiting different phenotypes...Ch. 7 - Describe how you would genetically design a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For S phase to be completed in a timely manner, DNA replication must be initiated from multiple origins in eukaryotes. In S. cerevisiae, what role do S phase CDKs and DDKs play to ensure that the entire genome is replicated once and only once per cell cycle?arrow_forwardDuring the process of transcription, the polymerase must handle several distinct polynucleotide chains: the double-stranded DNA ahead of the polymerase, the single-stranded template DNA, the nontemplate DNA strand, and the freshly-synthesized mRNA. How does the polymerase keep each of these strands--as well as the incoming ribonucleotides needed for the polymerase reaction--separate?arrow_forwardHuman Fbh1 helicase is important in the process of DNA replication. When a mutation occurs during the production of Fbh1, the result is a mutant Fbh1 that binds at the replication fork and prevents any helicase protein from attaching to the strand. Based on this information and the image shown, what would happen during DNA replication if this mutant helicase were present? A - Topoisomerase would unwind the DNA and an RNA primer would attach to the DNA molecule and initiate replication. The process would then stop at the blue triangle because helicase is needed to separate the strands of DNA. B - Topoisomerase would unwind the DNA, but then the process would stop at the blue triangle because helicase, the RNA primer, would not be able to attach to the DNA molecule and initiate replication. C - The process would begin at the blue triangle when topoisomerase unwinds the DNA and an RNA primer attaches to the DNA molecule and initiates replication. DNA polymerase would begin the synthesis…arrow_forward
- For S phase to be completed in a timely manner, DNA replication must be initiated from multiple origins in eukary-otes. In S. cerevisiae, what role do S phase CDKs and DDKs play to ensure that the entire genome is replicated once andonly once per cell cycle?arrow_forwardWhat factors promote the fidelity of replication during synthesis of the leading strand of DNA? prevention of mismatched nucleotides at the replication fork by topoisomerase Watson-Crick base pairing between the template and leading strand breaks that occur in the leading strand are repaired by DNA ligase removal of the RNA primers between Okazaki fragments by DNA polymerase I removal of wrongly inserted nucleotides by the 3'-exonuclease activity of DNA polymerase IIIarrow_forwardClustered sites where replication of multiple DNA molecules takes place are called transcription factories. a) True b) Falsearrow_forward
- Describe the structure and location of a D-loop.arrow_forwardAs shown, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand is replicated.arrow_forwardExplain how DNA polymerase and topoisomerase 2 contribute to replication in E.coli and what is the role of the role of the metal ions in the polymerase activity. B)How does the use of an RNA primer rather than a DNA primer affect the fidelity of DNA replication in E.coli?arrow_forward
- All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter chains, which would appear to require synthesis in the 3' → 5' direction on one strand. Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerasearrow_forwardBelow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.arrow_forwardInitiation of replication occurs at an "origin of replication" site that typically includes an AT-rich region. Initiation benefits from these AT-rich regions because: the AT-rich region recruits topoisomerase to begin the process of DNA replication. GC-rich regions are impossible to replicate because of their strong H-bonds. the AT-rich region recruits DNA polymerase to begin the process of DNA replication. adenine-thymine pairs are held together by two H-bonds, making them easier to separate during unwinding. None of the answers is correct.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY